TTHERM_00155590

Length: 2076 bp

cDNA Sequence

AAAATATCCAAAAATAATATCAAAAAATCTAATATCATTCATTCCTTTGCTATTAATTACGAAATGAGCCACTAAAGAAAAACTCAAAAGAAGAAGACTAACCAAAAAGAAAAGCCTGTTAAACCTGAAGGACCTTTCTTTTTATTCAAGAATGAAGTATTAAGTGATATCTAGAAAGATTTACCTGATGAATCTCTCTCTAAAATCAATGAAAAGATTTCAGAATAATGGAATGGCTTATCAGAAAAAAAAAAGAAAAAGTATGAGGACGAACACTTGAAGCTTCTCGAGGAGTATGAACATCACTTAAAAGAGTGGAATGAGTAGCATGCTCCTGCTGATAATGAAGAATAAAATAAAGAAGAAGAAACTGATAAAGTAAAAGAAATGGAAGCTGATAGTCATCCTACTCCTAATCGTAAAGGTATTAAAAAGTCAAAATCAACTACTAGTGGTTCCAGATCAAATGCAAGGGCCTCTTAAAAGAAGGCTTCAGCTAGTAAAAGCAAGGACGCAAAGAAGGCAACAAATAGAAGTGGATCTAAGAACAAATCTAACAATAAGAGTAGAGGAAGCTCATCAAGCTCTTCTAAAAGAAATTCTTCTAACTCTAAATCTAAAGACCAAAAGAAAGCCAACAATGAAAGAAGTTAATCTAAGAATAATAGAAATTCCAGAAAATAGAATCACACTGATGAAAAGCATACTGACAACACTAAAGTTATGGAAGCTGAAAAATCATCAAGCAAGTCAAGAAAAAATTCCAAATCTAAAGAACCTTCTAAGTAGAAAGAAAGAAATTCAACTTCTAAATCAAAAGGAAATTAATCTAGAAGTAACTCAAAATCAAAGCAAGTAGGAAAAGTCGTAAAGATGCCTAGAAAATCAAATAAAATGGAAGCTGAAAATACATCTAGAAATAGTTCTAAATCCAAATCTAGAGGAAGAAATAACTCCTCAAAAAAAAGATAGTCAAATTCAAAGTCTAAGACAAGACAGGAATAATCTCAAAAAAAGAGAAATTAAATGAGTGTTGAGAAATCAGCCACTAAGCCAAGAGGAAGGTCTTAAGTTAAAAAATCTATGGAAACTGAACACAATGTCTAGAGAAGTTCTTCAAAGTCTAAATCCAAATCCTCTAAGAAGCACTCAAAAGCAAAAGAAGGTTCTAAATCTAGAAAAAACTCTCAATCAAAGCAAAGAAGCAGCTCTAAATCTAGAAATATTTCATAATAAAAATCAAGAAACAACTCAAAAGCAAAATCAAGAAATAACTCTAAGTCGAAATCAAGAAATAATTCTAAGTCAAAATCAAGAAGAGATTCAAAATAAGCTCAATCTAAGTCTAAACATGCAGGTGATTCAAAATCAAAATCCAGAAACAATTCAAAGGCAAAATCTAGAAATAACTCTAAATCTAAATCTAGAAACAATTCTAAGTCAAAATCTAGAAACAACTCTAAGTCAAAATCAAGAAATAACTCTAAATCTAAAAGAAGAAGCTCTAAGTAAATGCATGCAGAAACTAGTTCTACTAGAAAAAGATCTGTATCTAAAGGTAGAAGTAGTTCTAAATCAAAAAAAGAATCCTAATCAAAATCTAGAAATGGTTCTAAATCTAAATCAAAAGTGAATGAAAGTAAAAGCAAGGATGAACATGCTTCAATTTCAAATTAAAAATCATCTAAAAAGGAATAACATTAGAATCATGATGGCTAAGATGAAGTCTAAGAACATAAAAATAACCATAATTCTTCTAAATCTTCAAAAATGAGCAACCATGTCGTTTCAAGATAGGCATCAAATCTCAATGACAAAGTTTAATCTGAAGATCAAAAGTTAATAAATTAACAATCCGACATGGTTAGTTCTTAAAAATCTAATAAAGTGAATGTTTCTTTGAGTTCTTCTTAAGTTAAAAATACCCATCAACATGCTGATATTGCAACTATCCAACCTGATTCTTAAAAGAATTCTAAATAAAAGGTTGCTTCCATTCATAATAGCTAAGTTTAAGATACTCATGCTGTTTAAAATGCTGATAATGGCTTACAATAAATGAATGCTGAACAATGA