TTHERM_00158210

Length: 804 bp

cDNA Sequence

AAGATTTCTAAAGTAATAAATAATATTAAATCAAATAAATAGCAAATGTCATCAAATATCAATTTATACGATACCGATTGTTCCACCTGGTCTACTAACGGAAAGCTCCTTTAGGTTGATTATGCCACTAAAGCTATTGATCAAGGTTCTATTACAATAGGTTTAAGATCTCAAAAGTTTGCAGTTTTAGTTGCATAGAAGAGATCTAACAGTAAGTTATCAGGTTACTAAGAAAAGATTTTCTAAGTTGATGATAAAATTGGTATGGGTGTTGCAGGTATTACTGCTGATGCAAGAGTCATTTGCAAATATATGAGAACTGAGTGTCTTAACCACAAATATGTATATGGAAGCTAACACCCTGCATAGAGATTAGTCATTAAAATTTCTGAAAAATCATAACATAAGACTTAAACCTATGGCAAGAGACCTTATGGTGTTGGTACTTTGATTATTGCTTAAGAGTCAGACGGTCCTAAATTATTCTAGACTTTACCCAGTGGTGACTTCTATGAATTCTATGGTTAATCTATTGGATCTCGTTCATAAGCTGCTAAAACCTATTTAGAAAATAACTTAGAATTATTTAAGGACTGCAATGATCTCAATACCCTTATTTTACATGGTTTGTCTGCTCTTAAGAAAGCCAACTAAGGTGAAGAAGAATTATTGCCTTAAAGTGTTGATATTGCCTTCGTTGGACTTGAATCTAACTTCACTCTTTTATCTGAAGATAGAGTTCTCTCATACTTATAACAATTAGATACATTTGCCCCTGCTAATTAGATGGAAGTCGAAAATTGA