TTHERM_00158320

Length: 3534 bp

cDNA Sequence

ATGGGAAATTCAGGCTCAAGTTCTTCAAATTTAGATCAAAAAAGTAGCAACGATCTTCCTGAGTTTGAAGACTTAGAAGAAATTTAGCGTTAGAAGTAATAAGATTTGCAAAGAAGGGAAAGGTTAGCCATGCTGGAAAGATAATAATATGATGAAGGATATTAGTCACCCCAAAAATAAAAAAAGCCTGATTTTGATAGCCTTTGCCCTGAAGAATAAATAAGCCATATTTTAGAATAACTTTTATAAGTATCTATTGTAGAAGAATAGGGAAATCAATTCTTTTCGCTTAAGGAAATAGAAAACGATTTGATTGATCCAAAATTGAAGAAGCCGCTATTAAACAAGTAAAATGTGTAGGATTTTGTTATTTATGAAGTCTTACAGAGCAAAATTGGAATATTTTTTGAAAATCATGAAGAAAGAGTGAAATATTTATTTTCAGTCATTAAAAAATGTGCTAATAATAAAAATATTATTTTACAAAAAAACAATTTTGCTTAAAGTGATAGTGAAAAGAAGGTTTAATAGTAGCAGTTATTAATTTCTGCTGATGACTATGATGAAATTATAGAATCAAGCTTTAATTATATGATTACTTTGCTAACTTAATATGAGTCTTTTGATCTAGAAGGTATTTAGGATGAGAAGCATAATAACATCTTTGATATCAGTAATATATTATTAGATGCATTTTACAATAACTTCAATAGATATAGCGCAATTACTTTTAATGAAGTTATGGACAGACTCAGTAAGCATGATGAATTCCATAATATTATGAATTCAGTATTCAAACGTATTTACAATAACATAAGAGAAAAGGGAAGCATTGAGAATATGGACCCTTTTTCTAATTCAATTGATAGAATGAAATAACTTTTTACTAAGGATTACATTCTTGATTATTTTTTAAATAGTTCTCCTTTATTCTATTCTGAAAGTCTTAAGTATGGTCTTTATTTAGAAGGCAATACGATATTTGGGCTAATGCTTTCTCTAACTACTTTCCCTGACTAATGGGAAAAATTTATGGAAGTTTTTAAGTAAGTTAATTTAAGGTTTAGTAAAGAAGTATAAAAACTTATTCAAGAAGATACTAAAATTATAAGAAAAAAAATTAATGAATTTCATAAGCTCTTCTACTAATTGCTAAACATAATAGCCAAAAAAAGAAAAGATAGACTCATATTTTGGATTGAAAAAATTTTAGATATGAATAAGGGTATTCTCAAGACATATCATTCTCATGAACATTGTTCAAGTCCTGGATTTTTATACAATTTCTTAAGGATACTCCTGCACTTTACTTAATCCCTAACATTAGATTTTAATACAATGAATGAAGTTATAAACAATCTTGATTTAAATATCATTACTGAGCCCACTGGCTTCTATAAATTTTTTGATCACATTCAAATTTTTGACAAAGAAAAATATGAAAAAGAAATATTGAAAATATAAATGTAAAAAAGTGGAGAAGATTCATAGCCTAATTAATAACCATAAGAAGGGGAAAAAAAGGGAATAGTAGGAGAAAATTAAGAAGAAGAGTAAAAGTAATCTAATCATCCACAAAGCAAAACATCATTAAGCTAAGATTAAACACAAAACATTTAATTTATTTCTCAGATTTATCGTTTTGTAATGGCAGCCATTCATTTGAATCTTCCATTTTTCAAAACCTTAAAGTCATTTTAGGAAAAACTACATTAAGCAAGCCACTTCAACTAGCACAACGTTGTTGAAATCAATAATTTTTTGATAAAGTAAAAAGAAAAATTATCATATAATATTCTAATAGAAGATCCCTATATCAACTCTATGTTAATTAAATTCTTTGAACTTTAAGTGTTGTATTGTTGGAAATTAAACAATCAGTAGTATGATGAAAAAGGAATTATAAACTAGCTCTAGACTGAATACACTCAAAAATATGCTCAATTACCTTTCTTTTTCATCGAAGACATAAATGAGTTTACATCTCTTGTCCTTATCTTATTTCCTAAAATTATTTAAGAATTTTAGAAAATCATAGACTGCTAAATAATAATGATGGGTAATAAACAATGGTGCAATAACCCACACTTTAGACAAAAGATTATAGAGATTTTTTCAATGATTATTGGCTTCGATAGAAATAATGCACTTAAAGAGTCCTCTCCTTCTTTTTTACTCAACTAAGGATAAGTTTGTCAAGAGTATATGATACCTGGGCTGTTAAAAGTGTTTATAGAAATCGAAAAATCGACTGATGGTCATCATCACTAACACCAATTAAATGAGAAATTTATCTTTAGATACCACTTTTGCAAAATTTTTACATACCTCTTAGAAAATTAAGAAAAGAAAAAATAAGATCAAGAAGAAGAATAGGCAAACAAAATTGCTTTAAGAGTAAACTAAGAAATGAAAATAAACAAAATTTGTTCAAACTAGCTTATTAAAATATCTCAATAAAATAAAATTATGTTTTTAGAGTTTGCAAATCTTTACTTTAATGATTTGATATTTTTATTAGATATAATTTCGAATTATATGTGCAAATTCTTTCACTTTTAAACTTTAAACAGAAATCAAGTAAACCATTTTGTTTACCATTAAAAGGAAAGTGAAGCGAAATAGAGCTAACAGCATGTAAAAAAGTATTATTAGTATTTAGCAGCTTACTATAAGAATATAGAAACTCTTTCTCTTTATAGTGAAGACATATTTCTCCAAGATGAGATCAAACTCAAACTTACAAATTTTATAAACATTTCTTTTATGAAAATATTAACATATCACCATCTCGATTAATTGAATGAGAAGGCATAAAAAGAGTTAGGCTTTGACTTAAAAACAGTAGTATTGTGTATAGTTAAATTGTACATTTAATACTCCTAATATGATAAATTCGTTTAAACACTTGTTGAAGATGAGAGAATTTTTGACATAGAAGCCTTTAAGAAATCTGTTTCAAAGCTATAAACTCTCAATATATTATCAGAAAGCATCTAAAATGAATTTAACTCATTCTAAAGTAGGGTCATTGAGATGTATGAAGAGAAGTAAAGAACTGAGGCACTCCTTTATGCCGAAGTTCCTGAAAAATATTTAGATCCACTGCTTAATCAAATCATGACTGACCCAGTCAAGCTACCAAAGAGTGAAGTTATTATTGATAGAGTAACTATTGTAAAGCACCTTCTCAATGACAAAACTGATCCTTTTACCAGAGACCAACTTTAAGAATCTGATTTGATTCCAATGCTAGAGCTAAAATAAGAAATATCAGAATTTATTAATTAGCAATTATAAAAAAATAAATTGAAAAAGTAAGCTAAAAATATTGAGACTGAAGAATAAAAAGATAACGAAGAAGCCATATCAACTTCTTCCTTTTTAAGTGAAATGGTTACAAAGGATGGCAATGAAGGATCAGTAACAAACTAAGCATTTAACTTAAATGAAATTAGAAGTGATATGGAATTGTAAAGTAGCAACAATATTGGTGACGATGTTCTATCAAATGATTAACAAAATGAATAATGA