TTHERM_00161600

Length: 552 bp

cDNA Sequence

ATGGGCTGTATCGCAACTAGAAATAAATTTTTGAAAGACAGCGACGATAAGGATGTTACTAGCGTGATAACTAATAAAAAGAAAATTGTCCTTGCTGGTTTAAAGGGATCTGGAAAAACTAGTATATTACAGAGGTTGAAACATAACACTTTCATACAAGTTGCTCCTGAGGGTTCAAGCATGTCAATTGAATAAATATCAATAAAAGATGATTTAGATTTTCTTATTTATGATATTGATCACTAGAATAAAAAATAATAAAATTGTCATCTCACAGAAGCAGATGCTGTAATTTATGTTATAGATTCTACAGATATTTAAAATATGTGGAGAGTTAAGGAAGATCTAACCAGAATTAGCAATGAAATGAGATACTCTGAATCTGTAGTACTTGTTTTGTTTAATAAGTTTGACCTCGAAGAAGCTTTGGATGCCAATACAATAATATAAGAAACAGGAGTTCATAGCGAATTAGATTTGGATAGATTAATTAAGAATGAATAGAAAATTGACAGTAAAGTAATTAAGATTGAATAAAAAAGACTTTCATGA