TTHERM_00171750

Length: 1083 bp

cDNA Sequence

ATGAATAGTCAACTTAATTAACGCAAGGATAGTGATGAGGAAGGGACAAATTTAGATATATTAGAATTAAGGAATAACAAGATTCCTAAAGTTTTGATGGTATTCATGTATATTTTAGGATTTATTAGTATAATTCTGATAAGCATTTCATTTGGATGCATGCTGTTCAACCCTGTTAATGAGTAGGAATATCTAAATAATATAAAATTGTAAGAATCTATTTAATTATGGGCAAATACTGAAATGGCTGAGGAGTTTAAATCTTATAAATTTGAATTAGTTGTAAAATCATTTTCTAAAGAAAGGAAGCTAGAGAAAATCCCTTTTTAAACTGCTGACAAGAGATTTAACTTGACAGTGTCTCCTGGATATTTTGAAAAATAGTTCAAAAACAATGAATATTTATTTGGTGTTTTTGATTTTGAATACTTTAATGTTCCTTTAGGAGATTCAGCATAATATTGCTTACAGATAAAATATTATGATAAAGTTAAAAAGGTTATTTATCATAAGTCTAGCTATTCATCACTCTAAAAAGAGCCTTAATGCTCTTTAATGTCTAGTAATAAGTATGATAAAGTAGATGCAACAGGAATCAAGATCTCCCCATGGAAATAAATAAAAACTGAATGTAGTGAATGTGTTTGCACGCAGGGAATCAAATAAATAATTGACGGATAGCAGTTTTGCTTTCAATATGAAGTGTTAACTTAAGTTTGCATTGTAGTTCAAATTACTCCTAAAAAATAAGTAGAATATTTAAGAGGCTGCTATAAAAACAATGTTTATTAAGTATTTAGAGCTGCCTAAGTTCAAGAAAATTTATCTTTTGAAGATTTGACTTTAGAGATAAGAGAAGTTTAGGATCCATATATAACGGCTCTTAGTCTTTCTTAGAATGACATTCCAATCAAATTTGAAAATGCTAATTTCCCCTCCATAATTAGACTCTTGTTTGAAATAGGTTTCGGAATTCTCGTTTTCACAATCATGCTAAATTTAGCATATAAGGCAAACAGGTCTCCAAGTGCAAACAGAAGACGCACAAGAATAACTTCAATTATTTATTTAAAAGACTAATGA