TTHERM_00171850

Length: 1959 bp

cDNA Sequence

ATGAATAAAAAATTATTAATCTTCATTGCCACTGTTTTAATTGTTGGCCTTGTCTATGCAGCTGATGATGAAAAGAAGAAGGTTGAATGCCCTGTCATTGGTATCGATTTGGGTACAACCTACTCTTGTGTCGGTGTCTACAAAAAGGGTTAAGTAGAAATCATTCCTAACGAATTAGGTCATAGAATTACTCCCTCAGTCGTAGCCTTTACTGATGAAGAAAGACTCGTCGGTGAATCAGCTAAGAACTAAGCCGTTAACAACCCTACCAGAACTTTATACGACGTTAAGAGACTTATTGGTCGTAAATACACCGATAAGACTGTCTAATACGACAAGAAGTTCCTTCCCTACGAAATTATTGAAAAGAATGGAAAGCCTTACATCAAGGTTGACAACGTCAGAGGTGAAACCAAGGTCTATGCCGCCGAAGAAATCTCTGCTATGGTCCTCGTCAAGATGAAGGAAATCGCTGAAACCTTCTTGGGTACCACTGTCAAGAACGCCGTCGTTACCGTCCCCGCTTACTTCAATGATGCCCAAAGACAATCTACCAAGGATGCTGGTGCCATCGCTGGTTTGGATGTTTAGAGAATTTTGAACGAACCTACCGCCGCTGCCATCGCTTACGGTTTGGATAAGAAGCAAGGTGAAAAGAACATTTTGGTCTTCGATTTGGGTGGTGGTACTTTTGATGTCTCCATCTTAACTATTGATGAAGGTGTTTTCGAAGTTATTGCTACTTCTGGTGATACTCACTTGGGTGGTGCTGATTTTGATCAAAGAGTTATGGACTACTTCATTAAGCTCACCAAGAAGAAACACAACAGAGATATTTCTGGTGACAAGAGAGCTATCCAAAAATTGAAAAGAGAAGTTGAAAATGCCAAGAGAAAGCTTTCTTCTACCATGACTGCCTAAATCGAAATTGAAGATTTAGTCGAAGGTTTGGACTTCAATGAAGAACTCACTAGAGCTAAATTCGAAGAATTGAACGCTGACTTATTCAAGAAGACCATCGGTCCCGTCCAAACTGCCTTGGAAGACTCTGGTTTCAAGAAGACTGATATTCACGAAATCGTCTTAGTTGGTGGTTCTACTCGTATCCCCAAGATCAGAAAGCTCGTCCAAGATTTCTTCGGTAAGGAACCTAACACTGGTATTAACCCCGATGAAGCCGTTGCTTACGGTGCTGCCGTCCAAGGTGGTATCATCTGTGGTGAAACCTTCAGTGAACCTATCGTTATGATTGATGCTACTCCCCTCTCCTTAGGTATTGAAACCGTCGGTGGTGTTATGTCTACCATCATTCCCAGAAACTCCGTCTCCCCCACCAAGAAGACTTAAACTTTCACCACCTATCAAGATAACCAAGAAACCGTCACTATTCAAATCTTTGAAGGTGAAAGACCTATGACCAAGGACAATCACTTGTTGGGTAAGTTTGATCTCACTGGTATCCCTGCTGCTCCCAGAGGTCAACCCCAAATTGAAGTTACCTTCGAAGTCGATGTCAACGGTATCTTACAAGTTAGCGCTGTTGAAAAATCCGCTGGTGTCAAGAACCAAGTTACTATTACCAACGACTCTAGTAGACTTTCTAAGGAAGAAATCGAAAAAATGCTTGATGATGCCAAGAAATTCGAAGCTCAAGATAAGGTCGCCAAGGAAAGAATCGACGCTAAGAACTCTTTGGATTCTTACGTCCACTCTATGAGAAACACCGTTGAAGACGAAGCTAAGCTCGCCAACAAAATTAATGAAGATGACAAGAAAACCATTAAGGACGCTCTTAAAGAAACTTAAGACTGGCTCTCCGCTAACCCTGAAGCTGATAAAGAAGAATATGAAGAAAGAAAGACCAAACTTGAAGGTATCTGTAACCCTATTATTAGTAAGGCTCACCAATAAGCTGGTGGTTCCTCCCACGCTGATGAAGATGTTAATGTCGATCTTTGA