TTHERM_00181100

Length: 1446 bp

cDNA Sequence

ATGGATACAATTTAATAAAGCGAATAAGGAAATATACAAATATCTTAAGAAGGCCAAAGTGAATAGAAAGCTAACTAAGATATTAAAAAAGATGAAGAGCAAAAAAGCGAGTCATTAGAAAGTGAAGACTTAGATAAATTTTCTAAGGAAGAAATCATTAAAAAATATTTGTTCATAAAAAAGGAAAATTAAGTTTTAAGAAAATAATTAAACCATAACAACGACACAAAAGCCCCTATTCCTAATAATAGCTCTTAAAATGAGACTAAAAAGTAAAAGAAAGAGCAAAAATAGAATAACAAAAAGGAAAGCCTATTCGAAATCTACCAATAACAGCATTATGCCTTAAAAATGTCTTATGTTGGAATCAATTATCAAGGCTTAGCATATTAGTAAGAAACTGACAACACTGTAGAAGAATAGCTCTTCAAGGCACTTGAAAAGACAACACTGATAAAAAATAGAGATAATTGCAATTTCACACGTTCAGGAAGAACTGACAAAGGAGTTAGTGCTTTAGGATAAGTTATTGGTATCACTCTTAGAACTTCAATAAAAATAGGTGAAAATATTGATGAAATAGACGACATAAGGATTTTAGGTTGTTCTAAAGTTGATCCTGCTTTTAATGCAAGATTTGATTGTTAAAAGAGAATTTATAAGTATTACTTTTTTGAGAATTAGATGGATATTTAAAGAATGAAGGAAGCAGCTAACCTCTTTTTGGGAGAACACGATTTTAGAAATTTCTGCAAAATAGATGTTTTGCAAACACTTAACTATGTTAGAATTATTTATTAACTTGATATAGAAGAAGTTTAGGCTAATTTTGGTACTCTTGACCCTCGTTCTAAATTATATGTAGCAACTATTCAAGGAAGTGCTTTCCTTTGGCATTAAATCAGAAACATGATGGCTATACTTTTTCTAGTAGGCAGAAAATAAGAAGAACCTTCAATAGTTACAGAGCTTCTTGATATTTAAAAGAATCCATCTAAACCTAATTATGAGATGGCTCCTGATTATCCTCTAGTATTATTTGATTGCTTGTACAATAATGTTAGTTTTAACTACAGTAGCGATTAGATAAAGATTTATGAACATTATTTGCAGATAATCTAAAAAAAGTGTATCGAAAATTAGCTTTATATTACAACTCTCAATTATATGGCATAAACTGCTTAGCAATTTAACAATTATAATCTTATTTAAAATTCATTGATTTCAGAAGAAGCTACTCTTCGTAATAAGAAATACTAGCATCTTTCAAAAAGATAATGTGCTTAATCATCAGAAGACACTTTAAAAAATTTAAAAGGCAGAAAATTAGATAAGTTTTTAATTAAGCAAGAAAAATAGATAAATTATTAATAGTAGCGCGAAGCAGAAAAGAATTTATCATAAACATAAGATTAAACCTCTGAAGGAAACGATACTTAAGAATGA