TTHERM_00185310

Length: 801 bp

cDNA Sequence

ATGGGAGATGATAAAGAATACTAAAAAAAGCAGAGAGAAATTGAAATTGAAAATTTGAATATGAGAGTTTTGTAACTAGAAAACAAGCTTAAATTGTATGAAGATAACGAGCTGGCCAAACAAAGAATTATTGATTCAGAAGTTGAAAAAGAAAAATTAAAGAACTAGGAGATCGTTGATAGGTTTAATTAAAAATTTACTTTCTTTGAAGAATAAATATAGATCTTGGAGGGCTAACTCCTTGAAAAGAACAGATACATTTTGGAACTTGAGACTCAGAATAAAGACTTAAATTTCTTTAATTAACTTGTAGAAGAAAAACAAACACTGATTGAATCACTCAGAAGAGAAAACCAAGTCTTAATTAGAAGGATTCGTGAACAGTTCAGAGATGAAGCTTTTGGAAAAGAAAAGTTTGATTTTGAAGAAGAGAGGAAATTTATTTAAGAAATCATCAAAAAGAAAGAGTAACAAGGACTCTTTGTAGATGGCTTTGTTTCCAATCACAGAAAAGACAGTCAAATCTCTGAAAGTGTAAGGTAATAGCAAAATGTTGAGTAAAATAAAAGATACAGAAATGAACAAATATAGCAACTCTCTAATTACAATAACGTAACAGAAGAACAGAAACTTGCTAGTGAAAATCGTGCTGATTCAATAATTGACAGATATGAAGCAAATTAGACATAAAAAAAACTTTCATAGCAATATCCTTAACCTTCAGAAGCCGAAAAAGAGGAGATTAGAAAACACTAGGAAAGACTAGAGAAGTTAAAATTAAAATATAGATAAAGTTAATGA