TTHERM_00188470

Length: 1146 bp

cDNA Sequence

ATGGCAGACAATAGGGAAAAAGTTGATTCAAGAAAGCTTTACGAAGACTAAAAGCTACTAGATATTTTAGAATAGAGAAGTTTATAATAGGATTAATCTTATCGTGAAATCTATAAAAAATCTCATATTCTTTAAAAGCAATCCTAATTTTAGGATGATAAAATAGTAAAATAATCTGAGCTTGATGATCTTTTAGGGAGAATTAAAAAGGTAGAAAAATTAAGACAAGAATCAAAATCATACACATGGAAGGATCCTCAATATTATCATGCTTTTATTAGAAAAAATTTAGATTTAGCTAGCAATTTAACCATGGAAACCATTTGTCTGCTAGTTTGCTATCCTTTCAATACAATTAAAACAAGAGTATAAGCAAAACATCCTTTAGAAGATATAAGCTTTTTTACTAAAAATAATGTTTCTAAATACCCTTTATATAGAGGTATTGGATAAGGCATGTTGGGAACTTTTATTGGTGTTACAATGAATAATGCTGCTTACAGATGGATAAATATTGAAATGATGAAAAATTAATTTGTTAGCAATTTGTCTACATTTTAAAAATAACTTATGTGTTTTTGCTTTGCAGATCTATTAGCTGCTCCTTTCAGACTTCCTTTTGAAGTCCGTAAAATATATCTCCAAATGAATTCTGGAGAAATAAGCTTTAATAAATATATGAATGGAATGAGATCTGTTTTATTGCCATGCCTTTTAAGAGATTTGACATACAGAATTGGTTTTAATACAGTGTTTTAATTGTGCCTTCATGGTTAAAATTATGCTTAAATGTACTCCAATAATGATCCTTATTAACGTTAATTAATTTAGAGACATATAGATAGGGCTATTCCAAATTAATCTGATTACAATAAAAGAATCACTGGTATGATTTTAGGATCATTATTTGCTATTTTGATTAGCAATCCTTTTGATTTAGCAATTACAAGATTAGTAAGTTAATAATATCCTAAATATGATGGATTCTTCCACTGTTTAAAAACAGTTATTAGAGAAGAAAAATGGCCCAAACTCTTCTTTAGTGGATATTGGGCAAGATCAGTTTATTACATGATATCTGGTTCTATTGTTTTTAACTTCTATGACACCTTCAGAGGTATGATAGAAGAAGCTTATTAGTATTGA