TTHERM_00188760

Length: 378 bp

cDNA Sequence

ATGATTTCTAAACACAGCTAAGCATTTGAACAGCTGGGATATTTATTTAACAAAAAAGAAATGTATGATAATGATGCAATTACGCTCATTTAGAAGGCTGATTAACTTGATCCTAAAGACAGCTGGGAGGGATTATCATTTCTGAAAAAAGAAATTTTGGCATTTGGAAAGCTAGGATTTTTATTTCAGAAAAAATAAATGTATGATGATGCAATTAAATTCTACTAGAAGGCTTTTTAAATTGATCCTAAAAACAGTTGGGCATTTGGAAAGCTGGGATATTTATTTTATAAAAAAGAAATGTATGATCATGCAATTCCATTCTTCTAGAAGGCTGTTTAACTTGAACATAAGTACAGCTGGGATTATCATTTCTGA