TTHERM_00188860

Length: 699 bp

cDNA Sequence

ATGACTTCAACTTAGGTAAAATTACAATAGCTTGACTTGTAAAGAAAGGATATAGAAACATAAATTAGCGCATTAAATAAAGAAATTAAGTATTATGAAGACAAAAATTATAACAAAAGTTTAGTTGATGAAGAAGGTTTTCCAAGAGCTGATTTAGATTTTGGAGAATTAAGCACATACAAAAATCTCAAAAGAAAATTTAATGGTTTAGGTGATTTACATGAAGAATACAGAGAAAGTGGATAAGCCTAAAGGGATTTAGAAGAATATGAAAAGAATATGGAAATAATGAAAAAAACTGAAGCTGCTGAAAAAGCTAAAAAGGAATATGATGAAGATATGAAAGATGAAAATTTAAATGCAGAAATAAAAAAAAATATTTTGATTCCATTTGCTTATATAAATGAAGTAGTAGATTAATCTCCAGCATTTTAAGCAGGTGTTAAACTAAACGATTTAATTGTTTCTTTTGGTCCTGTAAATCATTACAATCACAAGGAATTATAATTTTTGATAGAAACTGTTAAATCGAATGTCAACAAAGAAATTCCAGTCTAAGTATTAAGAAAAAATAATAAAATATAATAGTCTGAATAATTTTACTACAAGAATGAAAATTACGAACTAGTAAATTTAACTCTCACTCCTCGTACATGGAGCGGTCAGGGAGTCCTAGGGTGTCGCTTCAAATTAGTTTGA