TTHERM_00192090

Length: 1245 bp

cDNA Sequence

ATGCTCTCCAGAATTCTTACTAGACACTTCTCCCTTTGGGCTGGCGTTCCCAAGGCTCCCCCTGATCCAGTTTTAGGTGTTGCTGAAGCCTTCAAGAAAGACCCTGCTACTAATAAGGTTAACCTCTCTGTTGGTGCTTATAGAGATGATAATGGCAAGCCCGTTGTTTTAGAATGTGTTAGAAAAGCTCAATAAATCGTCATTGAGAAGAATCTTGATAACGAATATTTACCTATCTAAGGTAATGATGTATTCACTCATGCTGCTTTGAAGTTAGGTTACGGTGATGCTTTTTACAGTTCTAACAAAGATAGATTAGCTGGTGTTCAAGTTCTTTCAGGAACTGGTGCTTTGAGAACAGGTTTTGATTTCTTAAAGAAGTTCTTGCCTGCTGAAACTACTGTCTACGTTCCTAATCCTACCTGGCCTAATCACAACAATATTGCTCGTGATGCTGGCTTTAAGGTTGAATTTTACACCTACTATGATCCTGCTACCAAGTCTGTTAACTTCTCAAAGCTTTTAGATGAAGCTAAAACTTTTAAGAATGGTTCTGTTTTCATTTTACACGCTTGTGCTCACAATCCTACTGGCTGCGATCTCTCAATCAATCAATGGAAAGAACTTAGAGACGTTTTCCTCAAGAAGAACCACATTGCCTTCATGGATATGGCCTATCAAGGTTTCACCAGTGGTGATTGTTAAAAGGATTCTGAAGCTGTTAGACTCTTTGCTGATTCTAATGTTAACATGCTTTTGGGCTAATCCTTCGCTAAGTCTATGGGTCTCTATGGATAAAGAATAGGTTCATTATCCGTTTTGACTCAAAACGCTAACGAAGCCTAAAACGTTCTTTCATAATTAAAGTAAGTCATTCGTCCTAATATTTCTTCTCCTCCTCTTCACGGTGCTAGAATTGCTGAAATTATTTTGACTAATCCTGAACTCTTACAACTTTGGTACAGAGAAGTTAAGATTATGGCCGACAGAATCGCTTAAATGAGAGTTCAATTAGTTAAGAATTTAAAGGATGTTGGTTCTCAACACGATTGGAGCCATATCACTAACCAACGTGGTATGTTTGCTTACACTGGTGTCAATAAATAATAAGTCGAAAGTTTAATCAACGACTACCACATCTATTTGGTTGGATCTGGTAGAATCAGTATTGCTGGTTTAAACACCAAGAACGTTGGTTATGTTGCTGAAGCCTTCCACAATGTAACTAAAAATTCTAAAGTCTGA