TTHERM_00193700

Length: 2271 bp

cDNA Sequence

ATGATAGGAAATTTAGACAAAAAAAGAACTGATAAGAGAGTAGTGATTGGTGGCATTCCAAAAAATAATATAGATTTAAGGATACTTGAGAAGCCAGAAAAGTATACTGTAGTATAGAAGAAAAAGACATATTAAGACATTAAATTTATTATTACATGCTTAAAAAACCACTTCGTATTTTACAACTTACAAGACTCGTAGCTGGAGACTTTAGTAAATGAGATGAGCTATTGTGAAGTTAACCAAGGAGAGTAAGTAATCAAGTAAGGAGATGATGCATTTTGCTTTTTCCTTTTGGAAAAGGGAGAGATAGAAGTTCAGGTTAATTAATAGAAAGTTAGAAAATTAAAAGATGGTGAAGGGTTTGGCGAATTGGCCCTTCTATACAATGCCCCTCGTTCAGCTACTTGTGTTGCTTTATCCAAATCTTACTTCTGGATGATTGAAAGAAACACATTTAGGAAGGCTGTTGAAGAAATGATTACGTAGGAATACCAATAAAATAGGAAATTTATAGAAAAGATAACTTTTTTCTAAAATTTGACTTCAAATTAGAAAGACGCAATAGCAGGAGTATTAATTGACCAGCGCTTTTTGAAAGAATAGAATATTGTTAACAAAGATGATCCAGCAAGTTCATTTTACATTATTAAAGAAGGTAAAGTGAGTGTAATGCTCGGTGATAAAGAAGTAAGAACTTTGGGTTAAGGTGAATCTTTTGGCGAAACTGCACTATTACAAGGAGATTAAACTAGAACTATGACTATTAAAGCATTAGAAGACACTACATGCCTTGCCCTAGGAAGAGACGTACTTACAAAGTTACTCGGAGACAAAGTTGAAATGATCATATATAGAAACATATCTAAGTGGGCCTTAGAAAAATCTGATGGTTTCAAAGAGCTAACTATTAACTAACTAGATAAAATATTAGACAGCATATAAATTTCTCATATTACTAAAGGTAGAGTTATTATTCCTAAAGGTACTTAAAAGGCACAACAGTTATACATCATTCTTAAAGGATCTGTTAAGGATGGAGATATTGTTTACTAGAAAAGTTAATTGCTTGGAGCAAAGGAAATTATTAATGCCGACGAGACTTCTGTGTATGAGTAAAATATTGTCACAGAAGAAGATTCAGTTATTGGTTAAGTGAAAATTTCTGACCTTGTTGCAAAGTTAAGTGGAACTTTATAGGATATTTTGAAGAAAAATTAAAAAGTTAGCGAATAGCTTGAAGCCAAAGAATCTTAAATCAGACAAAATATAGAAAATCTTACAATAGACGATCTTGAAGTAGTAAAAAAATTAGGAAATGGATAATTTGGATCTGTTTATTTGGTCAAAAATAAAGACACAAAACAAATCTATGCACTTAAATGTGTTTCTAAATCAAGCGTTGTTGAGACCAGCCTAGAAAAGCATTTAATTCAAGAAAAGAAAGTCATGCAAACAGTTAACTATCCTTTCATCATGAGATTTTTCCGCTCATTTAAGGATGACTACTATATTTACTTCTTACTAGAATTCATTTAAGGTTAAGAGCTTTTTGAAGTTATCAGAGAAATAGGTTTACTTAGTACTTGGGATTCACAATTTTACATTGGTTCTATTATTCTAGCACTCGAATATCTTCATTCTCGAAAGATAATTTATAGAGATATTAAACCAGAAAACATCATGATTACTCACAAGGGATATCTTAAGTTAATAGACATGGGTACTGCAAAGATCATGTAAACTAATGCTGGCACAATGACACGTACATTTACTATTATCGGAACTCCTCATTATATGGCACCTGAAGTTATTTCTGGTAAAGGTTATAGCTATTTAGTTGATCTTTGGTCAGTAGGTATTTGCCTCTACGAATTTATGTGTGGATATGTTCCTTTTGGTGAAGAAGCTGAAGACCCTTATGAAATCTATGAGGAAATTATAAAAAAGGAGATTAATTTCCCCAATTATTTAAGTGATCCTATGGCTAAATCTTTAATGGAATAGCTTTTATCCAGAGTTCCTGAAATGAGAACAGGAGGTTCTTACAGTTCTTTGAAAAGCCATTAATTCTTCAGAAATGTTGATTGGATTAAATTATCTGATATGAATTATTAACCACCTTATCAGCCTTCAAATTAGAGCTATTTAACTACAGAATAAGTTTTAAAGGCGCCTGGAAAGTAAATTCAATAATAAATCAAAGAAGAATTTGGAGCTCTTAAATTACCAAATGCATCTAAAGTAGTCGATTGGGACAAGATCTTTTGA