TTHERM_00194680

Length: 1029 bp

cDNA Sequence

ATGATTGAAGAAAAAATGGAAGAATAAAAAGAATTTGTTAAATGTATTGGGCAATTGAATGGTCATACTGATAAGATATGGTCAGTTTCATGGCATCCTACTTTAGATATATTTGCAACTTGCAGTAGCGATAAGACCATTAAAATATGGGGATTAAAAGAAAATAGTGAAAATTAGTATGAACTGAAGTAAACTATCTCTGATACTCATGAGAGAACAATTAGAACATTAGCTTTTTCTCCTGATGGAATGATGCTTGCATGTGGAAGCTTCGATAGCACTATATCTATTTATGCTCTCAATAATGGTTCATTCGAATTTGTGTCAAAATTAGAAGGACACGAACACGAAGTTAAATGTGTAGCTTGGGATTCTGAAGGTAAGTTTTTAGCATCTTGTTCGAGAGATAAGACCGTTTGGGTTTGGGATTACGAAAATGGCTTTGATTTTTCATGTTACTCTGTTATAGATGCACATACTTAAGATGTTAAGCACGTGAAATGGATTCCAGGTACTAATAATTTAGCAAGTACTTCGTTTGATGATAAGTTAAAATTATGGGAGTAGGAAGATGATGATTGGAAGTGCTCTGCAACCTATTCAAATCATTCTGCTACTGTATGGTGTGTAGAATTTTCCAAAACCGGATAATATATGGCCTCCTGTGGTGACGATAAATAAATTAAAGTTTACAAAAAAAATGAAAATGGAGCTTTTTCCTCCCCTTATATTGTTGAAACTACTATTAAAAATGCCCATGCAAGAACTATTTATAGTTTATCTTTTAGCGAAGATGCAACTTTCCTTGCTTCTGTAGGTGCTGATAATACATTAAATGTTTATTAAAAAAATATGTATGTAACAACATTTGAAGGTTAAGACAACAATTTATACGAATTACTAGAAAAGAAAGTAAATTGCCATTTTGCAGATATAAATTGTGTTGCTTTCCATCCAAGTAAGGATATATTGGTTACTGTAAGTGATGATAGACAAATTAAGCTTTGGTCTGTAGAAATAAACTTATGA