TTHERM_00202840

Length: 2466 bp

cDNA Sequence

ATGGATTAATTTTTTGTTCTTTAAGGTACTTCTGAGTAAGGCAATTCTGAGGTGCTTGAGATGCTGGGGTGCTCTTATGAATGTGATATTATCAACTAAATACTAAGGATGAAGATAACTTAAGAATTTGACAACAAAGAAGAAAAAACATTCAAAGATGTCAAGTACTAAATTCCTATTAAATAAGACACTTGCTTGGAATCTTTTACTATCATCTATAATTAGGATACTATTACGGGCATGGTTGTAGAAAAGGAAGAAGGAAAGTAGATGTTTGAATAAATGACAAGTGAAGGATAAACTGCACTCTATGCCGAGAAATCTGATAATGGAGAACTTATTGAGATAAATGTCGGAAATGTTGCTCCTAATGATAAGATTAAAATAACTGTCTAGTTCTCATCTATTATCAAGCTTGTCTTCAGCCAATATTTCTATTTGCAAATACCTCTAATGGAAAAATAAATGATGGAATCTTTTGAATATCTTAAGCTTAAACTCACTTGCACTGGCTCTCTCTAGAAGGTAGAGTGTATTTCCCATAACGTTTAGGCAAACATAAAAGATGGTAACGAGGCAAACCTCTTGATGACAACAAAGCATCTTAAAGGTTCAAAGTAATTCTTTGAACTCATTTATAGCTTTGAAGGAATGTACGAACCCTCTGTGATTTTAGGAGAAGCTATAAAAGAATCAGATGAAACTACTGCTCAAGAATAAGAAGAAAAAAACAAATCTGAAGAAAGTGAAAAGCAAGAGATTCCTACATCAGATGAAAAAAAAATGAATGAGAAGTAGGAGGATGAGATGGAAATAGAAATAGATGATATGAATCAAAACTTGAGATAGTCCTGCTTCATAAGCTTTACACCTGATTTTGGCTAAGAAAATAAGGCAATTATAGACCAGCACATTCAAGAGTAAATTGAAAAAGGTAAATAGGTTTTAACTGATGAATTTGTTGAACAGATAGAAAAAACTGTGTTAAATGCCGAAAAACACAGCAAGGCATAATTTTTCTTCTTAATCGATAGAAGTGGATCGATGTGCACTATTTTCTAAAAGGCCCGTGATACACTTATTGAATTCCTATAAAGACTACCTGACGATAGTTATTTCAATGTTATTTCTTTTGGATCTGGCTATCAATTCCTCTTTGAGGAAGCAAAAAAGAAAAATAAATAATCAATGAAAAGTGCTTTAGAATAAATTAGCAAATTCTCAGCTGACATGGGAGGAACAGAAATTTATCAGCCTTTAGAGAAAATCTTTTAATGTAAAAACGTGAACGATCTGTATTAAATGCAAATATTTTTATTAACTGATGGATAAGTTTCTTAACCAGACATGGTTGTTCAATTAATCAGAAATAATTCGCATAAAGCTAGAGTTCATTGCATAGGTTTAGGCAGCGGAGTAGACAAATAATTACTAAGGAGATGCTCTGAGTCAGGCAGAGGAGCTAATAGATAAGTTGATAATGCCTCTGAATTGAAAGAAGTTGTTATCAATGTGCTAGAAAATTCTTTTACTCCTAGCTATACTAAATTCCAAGTTGAATATGATAAATCTATTGTTGAGTCTATATATCCTCAATAAGACGAATTTCCTTCTGTCTTGAAAAATGAGCAATTTTTCATGCATATTTTCTTGAAAAAAGGAATTAATTTAAATGAGCTTTAAACCAAACAGAAAAAAGTAAAGATAAGCTACTATAACTGCACAAATATGAAATTTGAAAAGACAGAAATTGAACTGAATGGATAAGATTAGTTTTTGCAAGATTAAAATTTAAAAAAGACAATATTTTTGATAGGAAAGCAACTCTACCTCAATCGTTAATGCTCTAACTTGAAGCAAAGCTAAGAACAAAAAAAGAAAATAATTGAAGAAAGCGTTAAATACTAACTCGTAACTCCATTAACATCTTATATTTCCTCTTTGCAAGGATTAACAGATACAAGAGTTGTAGAATATGAAGAGTATAAAGTAGATTATACAAAAAGTACTTACCGCTCAACAGGATCAGCAGGTGGCAGACATAGAAAGAATAGGAAGAAATAAGGATCTGCAAGAAAATCTGCTCCTGCAACAGGTGGTGTTATGAAACCTATTAGCAAAAATAGACAAAAAAAGAAAAAATTAAATAATCTAAAAAGTATCTTGTTAAGTAAATATACCGATAACAAGCTTTGGAAATACGATTAGTAAATTATCCTGTAATTTATTGATTCCATGAGTAAATTATAAGAATTAATAGGATACTTTTTTTCAGCAGGATTAAGTAAAGACTTGCTTTGCTCAATAATTTTTTCTTTATACCTAGAAAATTAAAAAGGGTATCGCTAAAAAGAAGCTCATAAAGTACTATCTCAAGTCAAGCCTTTGATAGAACAAAGCATTAAGAAGTCATTTTTATCCTAAGAAAATGCCTTCAAAGCAGTTAAAAAATACATTAAATTATGA