TTHERM_00204150

Length: 729 bp

cDNA Sequence

ATGGAGGGAGAAGAATTAAAGTAGTAAGAGTTAAAAGTGAAAAAATTTATAAGAAAATCTAGGTTCACAAAAAGAAAAGAAAGAAGATAGAAGCTTAGTTAAGAAGCATAGGCTCATAAACAAAAAATAAGCGAAATAAGACATTTAGAAAAGGATTTTATTTGTGCTATTTGTTTGTAGTATATATGCTGCAGTACGAGCACTAAATGTGGGCATGCTTTTTGTGAAACATGCCTTACAGAATATGAGTTATTGTTTGATAAATGTTTAGTTTGCGATTCAAGCATAAAGAATTAAGAAATAAGGTCTTGTTTTTTACTAGACAATTTGATATAGGAGTTTATAGAGCGTAATCATCCATCAGAATTATAAAATTTCAATAAAAGAAAAGCTGAATGCATATAATAAAGATAAAAAAAGTAAATTTCAGATTGGCAAATCGGAATGAAAATAGATATAAGAGACTCCAATAATATTTGGTGTGTAGGGATTATTTCTCGTATCTAACCTAATAAAAATAACTAGGCATAAAACATTGTAGTCTGCTATGTGAACAATCTAAATATCCAAGAAGAATTACCATGTGCCTCTTCGAGACTGGCTCCTTTTGGATTATATAGTTCTAGAAAAGACATTCCTCATTACAATAATTGTTAAAATACATCTGAAATAGTCATTCACCTACCTACTCTTTCTGATAATGTTCCATAAAAATTATTTATCTAATGA