TTHERM_00209270

Length: 528 bp

cDNA Sequence

ATGATTCATCAAACAGAGTAGTATAAAATTATGAAAGTAGCTTAAATAGGAGGTGGGTATACAGGAAAGTCATCTTTATATTTGAGATATCTTTAAGGAGAGTTTATTGACAACCCTAATTATATTGGCGTTGAATTTTATACAAAAACTATTAAGATAGCAGAGGAACAAATTAAATTTTAATTTTGGGATTGTCACTTGAACGAAAAAATCTATTCTTTATATCAAAATTATTTTAAATAATGTTCAATAGTTATGATATCTTATGACATTACTAATAGATACTCCTTTGATAGAGCGCAATTATGGTGTAAAGATTACAATTAAAAAAAATTAAATAAAGTAGCTCTACTAGCTTTGATTGGAAATAAATGCGATTTAGAATAATAAAGGTAAGTTTCATATCAAGAGGGTAAACATATTGCAAAGTCTTTAGGAATGCTATTCTTCGAAGTCTCCTCTAAAACAGGTTATTAAGTAAATGAGCTGTTTGAAAGTTTAATAAGCTACGTGATCAATATTAATTGA