TTHERM_00218520

Length: 2835 bp

cDNA Sequence

ATGAATAACATTTTATCTTAGAACAATTCTTTTGTATTTAGTATAACAAACTTTTAAGATTGTTTTATACAAAATCTAAGCTCACTTAATTGCTCAACTTCAATCATTTTTCTTGGCTAATAAAAAAGTGGAGGATAAGTAGTAATATCATAATCAAGTTTAAAAGATAATTCTATTGATGGGTTTCATGGTGACAATTCATTAATAAATTTATAAGATATCCTCTATTTTACATTAAAATAAACAAAAATACTTAAAAATAAAGTTATAAATAATTAGCTTTCTTCGATTTTGAAGATAAGTTAAACTAATAATGTAAACATAACTGATTGTAAATTTACTAATAATTTTAATTAAAATGGTCAAGGAGGGTCAGTGCTAGTTTCTAATGCAAATCAAATTTACATATAGGACTCTAGCTTTCAAAATAATATATGCAAATAGAAAAATGGTGGTGCCATATATTTTATGAATACAGTCAATGTTGGAAAGCTAGAAATTTCTAATACCAATTTTATATTTAATCAAGCAGCCCTCTCTACAGGTGGAGCAATAAGTCTTGATTTTGTTAATCTTATAATGCATCAAACTTAATTGTACTCAAATAAAGCTTTAATAGGAGGAGCAATTTATTATTCTTAAGTTATACCTGATTTTGTTTTAGAATATTAGTAAGGAATCAATAACTCTAATCAAATTAAAAATAATTATGCCAAATTATATGGTATGAATATAGGTTCCGTTTTAAGATAAATCAAAATAGATGCATCAAATATTTCTTTGAATAGAGGTAAAGTTTCATATAATGGATAAACAGTTTCTATAAATAATGCAAAAAGTGGTGAAGAAATTATTTTTTCAAAAATATAACTTCTTGATGAAGAGAATCATCCAATATATGTACCTATACCTACAGAGCAAATTGATTATAGTAGCGATGTATAGTTAATACTTAGGTAGCTTAGTGTTTCTATTGAGTGTGAATAGAATAAATAAATACAATGCTCAGGATAGTTACAATCAAAGCAATACATAAATGGTGGTTATAATCTAAGAGTTTAGCCTATGTATATGCCTTTTAAAAATATGGCTTTGCAGATAATGTCAAATAATTAAAATTAATTAATTGATTCAAAAGGAAATATAATTATTAGTGATAATTAACTATAATTAGAAGTAAATATATAACTAGGTTAGTGCTCAGTAGGAGAAGTTTATAAGTAATTTAGTGAATCAATAATATGCGATATGTGCCCAGAAGGTAAATACTCTTTGGATTTATCTGAGAATTCTTGCAAGACTTGTCCTGATTCTGCAATCAAATGTATTGGGTCAAATATTTATTTAAAAAATGGATATTGGAGATAAAGCAACTTAACTGATGAAATTATATAATGCAGTTTTAATTCTTATTCATGTCAACCTCAAGACCCTCATTCTAAGTTTCTATGTGCTGAAGGATACATAGGTCCTTTGTGTTATTAATGTGATACATATGGAGAAATATGGGGTAAAAGATATGCTGTCTTATATAGTGTAGGAAATTGTTACAAATGTGAATAGAGTGTAATATACTCTTTTTAGGGACAACTTATAAGAGGTCTTTTCAAAGATTATGACAGACCATATTTAAGTTATTTGTTTGGTAGTAACTTTTCAGACAACTTTTCCTTTTCCTTTTTCGTTCCAATTTCCTTTTTAAGTAACTGGAAACTCTATGAGCGTTGTCTTTAAACTGCTTAGATGTAGGCCTTACGTGCTATACTTTAGTCTACCTGCGCTAATAATATGGGTGATAATTATTCCAGTGATCCTTTACATAAAAATATTAAGAGAAAAAAATTCTAAAAGATCTATTTTATTCTAGATAGAATACTCTTTTATATCTGTCGGGTGTGCATGATGAATTTAGTAATTTTGATCAACTTTTATGTAGTATTCAAAGTAAAGCCCTTCAAAAAATAGTATTTTAACAACTTGGTATAATAGTCTACTCTTATTAGTGCTCTCTCTTTATATTTTTCATCATTATCTCCTGATGTTTTGTATGAAAATGTAGTCTTGCAAGCTTTATTTGTGATTTTTGTAGCTACTTTAAATATTTTGTTTATTATTAAATTGGTGTGTGGATTAATTAGATTAAATATTCCAGCAGAAAAATTAGATAGAAATTGCTTATAAGAGATGTTTTATACTCTAAAACTAAAATATCCTTTACTTCTAGAAAACATAAAGATTGATAGTAAACAGAGAATTAGAGCTTTGATTAAGTTAAAATCTGTTTAGAAGAAATTTAGGTAGTTTTTAAAGTACTTAAAGAATAATAACTTGTACGAGTAAGAAAATTTCAAGTCATTATTTTGCTCTTAATAGCAGTCACCTTAAAATAAATAATTATTTGCTTTATAATCTCCAACTTTATAATCTCCAACTTTAAGCAATTAAATATTTACTACTTCCAATTAAAGTATTGACACTGAATTGAGAGGTCTGAATACTAAATTAGATAATTCAAGCAAAAATTTAAGAAGCAAATGGGCAAAATATTCTAAATTATCAAAGCAAAGTTCGTTAAAAAGCCGAGGTGAGAATTTCTAGCTAGCATTAGTCAATACAAAAGTTCATAAAAAATTTAGTAGATAAGCAACAGCTAGTGATAATGAAAGCTAGTCTATATTTGCACATGTGTTTGATAATTAATCTTCATAAATGTAAGAGAGTTTAGTTTAAAACATTAATTTTACTAATGTTGTAGAACAAGTATAAAAATAAAATGAAGTTGAATCAAATAATGATAACAATCATGAATTACACAATATTGACCATATTGAATGA