TTHERM_00218610

Length: 2253 bp

cDNA Sequence

ATGGAGCAACGAAAAAATGAAACAAATTTCGTTACCTAAATAGATTTTATTTTAAATTTCATTTACTATTTGAAGAAAAACTTTATTTAAGACACTGTTGAAATGAGCTTTGCCGACTTTATCAATTTTAGATAACAAATATTTTATTTGATTGAGAATGATTAACTATTTACTGCATTTATACCATTTGCAACTACATATATTTAGTTTTAATCTCAGTAAAATAGTTTATTGATAGAAAAATATGACAAAGAAAATGTTTAAAAGTTAAGCAATATCCTTAAAATGAATATAAAAGTTTTATTAGCAAAACCAGATAAAATTACTATTTCAGCAAACAAATATTTCTCAGATAATAGGAATAAAATGGATAAGACATTATTTGTAGTAGAAAAAAGCAAGTAATCTGTACACATAGCATATGATTCTTCAAATGAGAGATTACATAGATTCTGTTATTAAGGTAAAATAATCTATGAATAGAAAAATTAATAAAACCTAGAAAATACATATAAACCAATTAATGGTAATTAATTGAGTTAACAACATATTCAATTGTAATAAGAAAATGAAAGCTTAAAATAATAGATTTTGAAAATTTAAGAAGAAGAGGCATAAATTAAATAACAAAATGCTTAACTAAAATAAGAAGAATAAAAGTATAGAGAACAAGAGCTTTAGCTAAAATAGGTATTTGAACAATTAAGGCCTTTGCTATAAAATATGCTAAATAATTAGACCAAATAAATTGAGCAACTCTAATAGTTTTAGCCTACTCATAATAGAAATATTCCATAAAGTGATACTCTCTAACAGTAGCTTATTTAGTTAAATAATTCAGAGCTACAATTAAAATAATAATTATAATAACTATTCTTCCCCTAAAATAATTAATAGATTATCACTTAAACCTACTAGCCATAGTAGCCTGCTTAGAGCGCTAATTAATAATGGATTCGAAATGATTGCAATAATCAATTACAGTAGAGCTAAGTTTTACTAGAGACTAACAATAATTTTAAGTCTCAGTAAATCTATGATCAAAAAGGATTTATTAAATAATATAGTTTAGAAAGCAACTAACCATTATACTAAATTGATCCTAAACAATAAAATTATATTTAAAATAACAAAAGCAATTAAAGTTTTAATGAAATTTCTACAAATGACATATAAAATAAAAGCAACAATTCAGGATCAAATTAACATTTTTATTCTCCAAAATTAATTTAATAGCAAGTAGGTAACCAAAGCAATTATAATAATGATCTTTAAACTTTTAAATTTTAAAACAATTACTCAAACAATATCGCAGAATATGTTCATACTATTAAAACTAATAAGAGAGGTAATCTTTAATTAAATACTGATGATAATACATCAAACTGGACAACTTGTGATAAAATCAAAGAAAACAGAAACAAATAAAAAATTTAAGATTGTCCTATATGTTGCCAAAATAAATTAAATGAAGATCTTCTTAAGTTGAAATGTGGTCACTCATTTTGCTAAGATTGTTTAATAGAACATATTAATTCTTTAATTTCGCAAGGAAAACGTTCATTTGATTACTTTACTTGTCTTCATTGTAACTTAAAATTTAATCCTACAGAGCTATTTTTTATGCTTACAGATAAGTAAAGAAGCTAAATAGATGAATACTACAAAGATAGAAATATAAATTTCAAGTGTCCAAATTAAAAATGTGGTTAGTAATCTAAAATTCAAGAAAAAGAATGCTTGCTAAAAGAATTTTTTGTAACTAGTTGTTGCAAGTCAAAAGTATGTTCTAAATGCAAGCAATTATATCATCCTGACTTTAAATGCTAATCTTAAATTACAGAAATGATAGAACAAATTGCAGCTTATAGAAATTAATAAGCAACCGATAATGCTAGATTGTTCAGATTCTGCCCTGTTTGCTATTAATTTGCATTCAAAGATGAAGGTTGTGATCATGTTACATGTATAAAATGTAAATCAGATTTCTGCTTTAGTTGCTCTGCACCTAGACCATCTATTTTAGGTCATGGTAATCATTATCACAGAGAAGGCTGCCATTATTTCTGTGAGTACAAAGACCAAAAAGGAAATAAAGTAGACAATGAACTGAACCTAAAAAAATGTGTTTAATGTTAAAAAACTAAAAATCCATGCTAAAGACCTATAAGTTGGGATAAATTCCTTGTAGAAGTTCAAAATGAAATAGGTAATGAAATATTTGAAGCATTCCCAGATAACTATTTTCTTTGA