TTHERM_00219370

Length: 2979 bp

cDNA Sequence

ATGGCGCAATATTTCTAATCATCAAACAAAAGAGGAGAATTATTCGAATTGACAGAAGATTTAAACTCTAATTCCTATGAAAAAAAGAAAGAGGCTGTCAAGAAGGTTATAGCCCATATGACTATCGGAAAAGATGTTTCCCCTCTCTTTTAGCCAGTTATTAAATGCTTAGAATTCCCCTAATTAGAATTGAAGAAGCTCGTATATTTATACATCATTAACTACTCTAAAACAAAGCCTGACGATGCCATTATGGTTGTGAGTTAATTTGATAAGGATATTAAAAATAAGCAAAATCCTATTCTTAGAGCTCTTGCAGTGCGTACCATGGGTTGTGTAAGAGTACCAAGCATCAACTAATATTTAGCTGAACCTTTAAAAGAAGCTCTTGTAGATCCCGAGCCTTATGTTCGTATGACTGCAGCACTTTGCATTCCCAAAGTTTATGAGGTTTCACCTGACATTATTGAAAATCATAATCTTATTTAATCCTTGTAAAATATGCTTACAAATGAAGCAAATGCAAAAGTTTTAGCTAATGTTCTTATAGCTTTAAACGAAATGTCATATTACAGAGGAAAGAATTTAATAACAATCACATAAAAAGTATTACAAAAAATGCTAACAGCTGTCAATGAATGTCATGAATGGGGTCAAGTTGTTGTTATGGACTACTTAGTTAACTACATTCCAGAGAACTCTAAAGAAGCTGAAATGATCGTTGAAAGAGTTCTTCCTAGATTGTCTCTTATTAATCCTGCTGTAGTATTTAGTGCAATTAAAGTAGTAATCAAGTTTATGGATTATATTACATCAGTTGACATTGTTAAAAACTTGAGTGCTAAAATATCTCAAAATTTAAGTAATCTTTTTTATTATTAATAATCTGAAATGTGTTTTATAATTTTCATCTATTAATATTATAAAGTTTCTTTAATATCATGGCAATAACCTTAAATTTAATACGTTGTTTTAAAATGTGTTCCTCATATTCTTCAAAAGAGACCTGGAATTATGGAAAAGAACATCAAGGTCTTCTTTTGCAATATTAATGAGCCATATTATATTAAGAATGAGAAGCTTGACATCTTAGCAAAAATTTGTGATAATAAGAACTACGAATCAGTGTTAAATGAAATCAAAGAATACGTTAATGAACCAGATCCAGATTTCGTTAGACGTTCTATTAGCTCTTTAAGCACTATAGCAATTAAATTCGAAAGAGCAGTTGATAAGACAATTGAAATTTTAGTAGAATAAATGAAATAAATTAGAGAAACTTACAGAACCACTGAACCTTATGTTTAGGAAATTATTATTGCAATGTAAAAAATATATAGAAAATATCCAAGTAAAATTAAGCATGAAAAAAGCTTGGAAGTTCTAATTAATATTGTTGATTTGGCCACCGAAGAACAAGCTAAAGCAGCTGCATCTTGGATTATCGGTGAATATGCTGAGTTCATTCCTAAAGTTGTTGAGCTTATAAATACCAGAATTTCAGAATTTTTACAAGAACAAAGAGGTGTTTAGTTAGAAATTTTAACAGCTGCTATTAAGATTTTATTGAAGTACCCTGATGAAGGATAACACTTCATCTAAAATCTTCTTGAATAAGCTTCATATAAGACTGAAAACCCTGATGTCCGTGATAGAATGTTGTCAATTGATACTGAAAAAGTTAAGGACACTGTTATTTGCAAAATGCCCTCTATCCAAGAAGACAATTATTCAAATGATACTGAATTTACAGACAAAATGATTGACAGTTTGGGTTTAATTTGTGCTGTTTACAGTAAGACTGTTGATGAAATGTTCCCTCGTCGTAGAAGAGTACCAACTAAAGATGCTAACGCTTCTCAAAACCAAAAGTCTCCTGAAAAATCTAAGATAGAAGATAAAAAGGATGATTCTAAAGTTGAAAAAGCTGATGTAGTAGTTGAAGATAAAAAAGAAAAGGTTACTTAACCATAAACTTAGGTTGTAAATCCTCCTGCTCCCGTTCAACAACCTCAACCTGCTAACTTAAATCTTTTAGAATTATTGGATGATGCTCCAACTCCAGTATAGCCTGTTACCGTTCAAAAGTAACCTGAAGTTAAACCAGCTAACAATGTTGGAACTGATTTACTAGATATGCTTGATGACCACGTTGTTCCTGCATATTAGCCAACTTAAGCTGTAAGCAACTAACCTGTTGTATAAAATAACAATGACTTTGACTTATTTGATTCTCCCTCCAAACCCCAAGTCGCTCCCATATAATCCTAAATAAACTACATTAATGTAATTAATAGTACAACCCCAGGAAAAACTGGTAAATCTGGATTACAGCTTGATGCTTGCCTTGTTTATGAAAATAATTAAATTGTTTTGAAGCTTAGAATTAATAACAGATCTACTTTATTAATTAACGAATTTCTCTTATAAATTTCTCCTAATTACTTTGGTTTGAAAATAAACGAATAACCTGTAGTCAACATTTACTAAAATGCAACTGTTGAAGTTCAAACCACTCTCTCATTCACAGGCAAATAGGATCCAACTAAATTACCTCCTAATCCTTATTAATTAATGATGGCTGTAAGAAATCAAATTGATACTTTCTTCTTTGATCTCCCTGCTAACATAGTGCATTTGTTGAGTCTTGATGGAAGAGTAACCCAAGATGATTTTAAAACTATATGGAAATCTATACCTGATACTACACATAGAGAGCAAAGTGTAGCTTTTATTTAGCCCCAATATTTCTAGATAGAATCACTTAAATAGAAGCTTAATGATAATAGAATTTTCTACATTGCAGCTAAAAATAAAAATAGTTATTATAGTGCTAAAATAAATAATACTGTTGTCTTATTGGAAGTTATAGTTCCAAGTAATACTAATCCTCAAGGAGCTACTGTTGGAGCACGTAGTTAAGATTAAAACGTCTTGTAACCACTTATTAATGGAGTACTTGAAATTCTCTAAAAATGA