TTHERM_00221000

Length: 681 bp

cDNA Sequence

ATGAAAGATTAATTTAGATAAGAATATGACCAAATAAAAAAGTTATAGCTATCAATAACAAGAGACATAACAAAGCGAGAGTAAATGAAAATTTAAGGAAAATCTCTAGGTTCTATTGATTCAGAAATCAGAGGATAACTAAAAAGTTTTGAATCTGATATCTTAAAAATTACTTAACTCGTACAGGATTAAGAAAGAAATCTTTAAAACTTGGGACTCACTGCAAGAGAAATTGAGCAACGAAGAAGCATGATAGTTGAACTTGAGAAGTAAAAAAAACAATAGTTAGATACTTTAATATAATAAGATAAAATGGCATCTAAAAATTAAAAAATGTAAAAACCAGCTAACTTTTAAGAAAAATATGATATTGAAGGACAGACAAACAAATAAATTTATAAATACTAACAATAAGAGTTGGACAGTTAAGATAAATAAATATAAGTTATGCTCAGTACTGTTAACAAAATAAAAACAGGTGGATAAAACATAGTTGAAGAAGTAGATGACTAAGTTTAGCTTTTAAACGATCTTGATATTGGATTAGATAAAAACACTTAATTATTGAATAAAAATTCTGGAAAACTGAAAAATCTTTTGAAAACGAACTCTAACTTTTGTTTACTAACATGTGTATGCTTAGAAATATTTTTGTTGATGTTTTTTTTAATATTTTTATGA