TTHERM_00225630

Length: 3675 bp

cDNA Sequence

ATGCCTCCTAAAAAATCTGGATAAAGCAGGGGAAACCAGCGTTAGGCAAACTAATAAAAATCAAAGCCAATTTCAGAGTATACTGATTATAATTTATATGAGTAATTATCAAGAGAAAATTGTTCGATTGAAGAGATTTTAGATCAAATAAAAGATGTAGATGATTAAGAAACAAAAGAGAATATCCTATAAAACTTTGTTCAGTTGATTTTTAAACTAGTAGGACTCAATAGTTTTGTGATAAAATTAGAAGACAAATAATTTTCTTCTATTGATTAGGATTTTTTCAAATCAGAAATAGAATCTAATTTAAAAAATGTTAAGGATTTTAATTGGGTTTTTACTACAAGAAAAGAAGAGCACTAGTTCCTCAAAGACAATCTCTTTATTTTCTTTGACTCAATTTTATAGCAAAGTCAATATTACAAATCAGAAAAAAAGGATGATTCTTTTATGGTAAATCTCTCTAATTTCCTAATTATGTTATCAAAATCCCATATTTAGAATGTAAGATAGAATGTATTGAGATTAGTAAGGATTATAGTTGAGTAGGGCTTGATTAGAATAGAGAAATTGAGGGCTGCTTAATAGAGAAAATTATAGAAAGAAGAGCAATATTTAAAAAACATTCTTGAAAACATTATGAATATATTGATTAAAGGTATTTTCCATAGTAGAATTTTAGATAAGAGTCAGTCAATATAGCAAGATTGTATTGAATCTTTTGAGATTTTCTTTAATATTTCTCCTTAAATGACTTTGAATTCTTAGAATCTCATTTAATTGTGTTATTTATTTGATTCTGATATTGATCTCGCTAATGCACTCTTAAAAGTACTTATCAATATAAAATGGAAAGAAACAGAGTCATCTTTGGAGGCTCTTAAAGAGTTAGTTCAATATGATAAATTCAGGAAGAGATTAATTTATTTTTCTAACATTTCAACATTTGTCACAAGTTACAGAGCTATTCAATTAGTTAACCTGATAGATGAAATTCTACCTGGATCACTCAACAACAAAGACTTAAAAAGAGCAATGGCAACTATCTTCCATAAATATGAAGAAGTCAGAGCAGAGGGATTTAAGATTCTTTAAAAATTTTTAGAAGTTAATGAGGGTGAAAGATAAATTAGCGTCATAAATCTCGAAGGAGGCGAAGACGATGGTGTTAGCGATATTTTCTAGTTCAAATAATAAACCAATTCTTTAGCCTGTTAAACTTTTATAAAGAAATTTTATACACTTTTGGATGAAGTGGATTCCAAAATTTATGAAAAAGAAGATTTGATCTAAAATATGATAAATTCTCTTGGTTTTGAATTTGGTGCTATTTACGATTTCCAAAATATTTTCCAATTGCTAAATTAGTTACCATCATCGAATTTAAAAGATAAAATTTTTGATTTGTTTAAATTGATTGTTATAATTTTGAAAAAAACGATGAAATTCTTATAGCTAATATCGTAAGGCGAGAATCCATCGAGCATTTACAACCAAAAGCAATCAGAAAAGTTGCTTATCATTAGAAATGAATTCTTTAAAGCCTTGGTGGCTAATTTTGATAACTTTTATGAGAATATGAATAAACACCCTATCTTAAAAGAGTATTCTTACCAATTATTGCTATCAATTCCAGCTATAGACCTCCAACAGAATTTAAAAGAAACCTAGTTCAAAACAATATCAAAGAAAATAGCTGAAGACATACTAAATACAATACTAAACTAAGATTCTTTCATTGAAGATAAATCTTAATCTATGGGACTTGTTTTTGGATGCGTTAGCACCCTTTAATACTTCCTCTTACACACCCCAAGGGCCTACATCGATCCTTTTAAAGAGACGTCTTTAGATTTGTCTTAGCTGTAAGAAGAATATACTTATTTGTTTATTAAATTGTTTAGCTGCACCAATCTCTTAAATTAATTGGATGAAATATATTGTGAAAGTTTTATATAAAAGTGCTTAGAAATCACTGATACAGCTACTTCATATACTTCAACTGACAACACTTGCATTTATACTTTTACTAGTTTAGGGTTACAATTAGACTTTTACTTGAACGTATTGAGAGTTGGATTGTCTGAATCTTGCTAAAAAACTTCAAGACTTGAAGAGTATCTTAAGTATAGGTAAAAAGTTATCAAATAGCTCTGGCTCTTCCTTAGAGAAGAGAAGAAGAAGGCAATTTAATTTAACTTAGAAACCTCTGAATACAAGAAAATACTTTTTAAATCTTACTATTCTGTCGTTGAAGGACTTGCTTTTGTTTGTAATTAAAAGCTTAAGCACTTGCCTATTTACATAAAGCTCCATTCCGACGATCCCTTATTTACTTCTTTGATTGATTATATTAGTTACTACATTCCTTAGGGTCAGATAGGAGATGAAAAGAAATTAGAATCAAATGAAAATAGCAATGATCACTCAAATAATAATGACATAAAAAACAAAATAATGGAAGCTGAAAAAGAAGATGAAAATAAATTGAAATTAAAACCATTTGAAGAATCTTATTTATTTTAATAACAATATCAAAATCAAAAGTAAATTTCTGATATTCAGATTATCTTACTTTAATTCTGTAAGTTGACGCTAAGCAATCCTAAATTTATTCATTCTCAGTTTGGTGTTTATATTTTTAAGAATTTCTTTGATTGTCAAAACAAAGAAATAGTTGATCTTCTCAGAAAGAATCTAGCTTGCTGTCGTCTTTAAGGTGATAAATAGTCAGGATTTCCTCCTTTTTGGAGAGCTTTTGATGAAATAGTGAACTAATTATTAGATGAAGGCAAGGATATGAGTGTGATTAAAAAGTTTGTAGTTTTTACTCATAAATCATATTTCTCAGAAACTATAAATGAAGGCAATGTCCAAGTGAAACCTAAAGAACATTTTAAGGAGCTCTGTGAAAGGTAAATTTATTTCCTGACAGCAAAGACAGCAGTCTTAATCAACACTCCTAATAAACTAAATACACTTAATGCTATTGGATATTTGCTTTAAATTAAGATTAACTACCCAAAATCGCTTGATCCCAACCATTTGATGTATATCCAATCGCTTTAAAAGAAGTATCAAACATTCTTTTTGAAAAAAACATAAGACTATGTGCAAGAATTTAAATAAAATAATCAACATCTCTAATCTCTAGATGAAACAATACTCTCTGAGAAATCTAAAGAGATTATTTACAGATATGTTAAGAACCTAGAATCATGGTCTTAGGTTAAATTTAATGTAGATCCTTATGGAGAGGGATAAGAAGCTCTCGAAAAGTAAAGAGAGCAAGCAGAGAGAAGTCTTAAAAAAGAATAAAAGCAAGAAAATGCTGATGAGAAATCTGATTTAGTAAGTGAAAGTGAAGATGAAGAAGTTTAAGATTAAGATTAAGAGGAAAGTGTAGAAGAAAAGAATAATACAACTGATAAAAAATAATCACATAAATCGAAATAAGTAAATAAAAAAACAAGAAGCAGCAGTAGAAGTTCATCTAAAAATTAAAAATCTTCAAAAAAAATGGACGAAAATAAATAAAAACCCACTTCATCAGTTAAAAAAACAAAGAAAGAGCAAAAATCATCAGTTAAAATAAACATAAAATAATAATAAGAAGAAAGCAGTAAAGTTGAAACTGTTAAAAAAAATCATAGAAGATAAAAGAAGAATTGA