TTHERM_00225720

Length: 615 bp

cDNA Sequence

ATGTAAAGTAAATAAGACTATGATACATTAATTAAGTTACTTATCCTTGGTGATTCAGGAGTAGGAAAAACTTGCTTTTTAGTGAATTACTGCAAAAAATCTTTTACTAGAATACATCTACCTACAATTGGTATTGATTATGAGCATAAATATGAAGATGTAGATGGAAAGCATGTTAAACTTTAAATTTGGGATACAGCTGGCCAAGAGAGGTTTAAAACTATTACTTAAAATTACTATAAAGGCTCTATGGGTATTATACTTGCATATAGTGTAACAGATCCTAATACCTTTAAAAATATAGCAGACTGGATGAAATAAATTAGCGAAAGAGCAGATCCATCTGTTAAAATAGTAATTATAGCTACTAAAATTGACATGAAAGATTAAAGAAAGGTCTCAACTTAAGAAGGAGAAGAGTTAGCTCAAAAATATGGAGTAAAATTTTTTGAAACTTCTGCTTTGGAAGGAACAAACGTCATAGAAGCATTTAAATGTATTGCTAGTTAAGCACTCTAAACAATTTAAGCATCTTCTCCAATTAATAACTTTAAAATAATTCAAAAACCTGTAATTTAATCTAAAAAATAAGAAAAAGATGCAAAATGTTGCTGA