TTHERM_00237640

Length: 2049 bp

cDNA Sequence

ATGTCAGAAGAAATAAAACCCGTAATTGCTTCATGCAGTAATATAGTACTTACTCATGATTTATAAAATCCTTATCCTCTACTGAGTAAAAGACCACACGAAGGAAATGTTAATTGCGTAGTATGGAACCACAACAACCTTGTACTAGCAAGCTGTGGTAATGATGGTAAAATAGTACTTTCTAACTCAAGAAAATAAGGAAATCTCATATAATTTGATGATGATATTTAAAATAGTTCTCCATTAACTTCAATATAATTTACTTCTGCTTCAACTAAATTAGCAAGCGGAGGAAGCAATGGAAGAGTTAAAATATACGATTTGAAGAATTAATGTATAGCAAAAACATATTCTAATCATTTTGGAGGTGTAACTTGTGTTGATTGGCATTAAAATGATTACATTTTAGCAAGCAGTAGTTAAGTTGGCGATATTTTTCTATATAATACAGAGAATGATTAATAAGTAGCTACATTTAGTGAAAATAATTCAGTTCAGCAAATAAAATTTTCTCCATAGAGAAATAACTACTTAGCTTCTTGTTGTGGAGATGGCAGAGTAAGCTTTTGGGATGTAAATACAAAATAATAAATTGCTGTCTTTTAAAATCATCAAAGTAAAGTAAATTCTGTGACTTTTTCTCCCCATAACAGAGTACTTGCAACCTCAGCTTCTTTGGATGCTACAATTAACTTATATGATATAAACGAAAAAAAAGTGGTCAAGAAACTATCATGTGATTCACCAATAACTTCACTTGCTTTTCATAGTGATGGATACACACTTATAGCTGGTACATTGTATGGCGAGTTGATGGTTTATGATCTCAAAAATTTGCCAAAGCCTAAGCTACTGCTTGAAGGTCACACAAAAAATTAAGCAGTTAACTATATTAGTATAATAAAAAATAATGAATCCAGATCTCAAGTAAATTCAAGTGCACCTAATTCATAATAAGCACCAAATAATAAAACTAGCAGCTTAAAAGACATTTCATAAACAAAATACCCATAAAATTTAAGCTAAGCTAGTAATTAAGAGCAATCAATTTAAGGCACAAAATTAAATGATACAATTTCGTCTTAAAAATCAAAAACTTCAGAAACATCTTCTATAAACCCTTCCAAATTTAACTAAAACAATAATTATGGAAATTATTCTGATAGAGATATTTAATAGAAATAAATAAACAATAATAACAACAACTATAATATGACTTCTCCTTCAATAAATAACTCTAATGGAAAGTAATTTAGTAACAATTAGTTTGCACAACCATTAAATTAAAACACTAGCATAAAAGAAAGTGGAATTTAGTAGCAATCACCAGCTCCAATATCAAAGTAGTCTCAAATATCTAATTCAAATACTCTAGCTAATAACACAAACTTGCAAAATATTTAAAGTGGAAAAAGTTCTCAAATAATCTAAAATAATTACGATAATCAAAATATATCTACAATTAATTCTTAGTTGGCCAGAAAATCAAGTGCTAATTATCAAGAAGAAGACAATAAAGGATAAAATGGACTTTCTAAAAACTATAGTAGCAAGCATATCTATAATTAAAATTCCATGATTTTAAGCTCTACAAAATAGTCTACTTTATTATAATAAAATTAATTATCTTCTAGTAAATTATAATCACCTGGATAAGAAGATTACTCAGAGATGAAGAGATCAGGAATAACTAATGTTCAGCCCTATGAGTTACCACCAAAAGCCTCTACAATAATAGAAAGAACTAATGGCAAAAACCTATCATAATTATAGTAATAGCCTTCACTGCCTACTTAATAAGGGGATGATTTTACAAGCAAATAAAAATAATATATTAAAAATATGATGGAAGACTATTTTTTAGATATGAAATTTAGCTTTTCCGAGTAATTTTAGAACCTGCATATCGAAATAATCCGTTAATTTTAAATTTAATAGAATGAGTTAACAGCCCTACTTGAGTAATATGTGAACAAGAATAAAGCTTTGGAGGAAAAAATGTAATAGTTGTAGTTAGAAAATGATAGATTAAAAAAATCAACTTATTGA