TTHERM_00238750

Length: 6279 bp

cDNA Sequence

ATGTTATTATCTTTAATATTTTTTTCATTTTCTATTTTCTAAGTAAATGGATAGTCTTGCTCAAACTCTTATATAGACTTTTAAGGAAACTGCATCTCGTAATGTACAACATTATCAGGAGCAGTTAATCCTTCTTCTTTTAACTAGCAATGTGTTTGTCCTCTTAATACTCCTTATATCAATCCCTAGAAAAATGGATGCATTCAAAACTGTTCTATTGCTAATTCTTATTCTAATCCAAATCCTTTAAATTATTAATGTATTCTCAATTGTCCTCTCACAATAACTGGATCATCTAATCCTACATCTTATGGATTATCTTGTATTTGCTCTTAATATGTTTCTTTTGATGGGACTTAATGTCTTTCAACATGTCCAAATTATTTATCATTTAACAAAAAAGTATGTGTAGACGACTGCAGCTCTATTTCTGGATCTCAAAACCCTCCTCTTTAAGGACTAACTTGCATGTGTTCTGATCCAAAATCTTTTGTAGGGCCAGATGGTATGAGTTGTGTAGCCTAATGCATAACGAGTTATAAACATATAGACTCTTATAATTAATAGTGTATTTCAAATTGTCCTTAGATTTTTGCAAATTCTTAAAATCCTACTAGCTATGGATAACAATGCATTTGTGGTGGGTCTTATCCTTATTTGAGCTTGGATAGAACTTAATGTATAGCTTCATGTCCAACTTACTCAACACCTAACTCATTTGGAATTTGCGTTTGCTCAACTACTCCTTACATTTATATAGATATAGCTGGGAGTAGCTGTATCGCTAGCAATCCTACAGCTTATATTAATCTTGACCCTATTTATCCAAGATTTATTTCAAATTGCAATTAAAATGTGAATGTTTAAAACCCAGTATCTTTCAATGCAAAATGTGTATGCGTTTCTGCAAATAAGTTCTTGAATTTTGATTAATTTAATAATTATTTTTGCTATTCTAGTTGCTTTTATTATTAATCAGCAGATTCCACTAACTTTTCATGTACCAAAGACTGTACTTAATTTACAAATATGGTAAATCCTACTTAAATTGGTTAAAAATGCTAATGCTCTTTAACTAATCCATTCCTATTACCTTCTAAATAAGCCTGTAGCTCTTCTTGCGGAACCAATTACTTAGGATTAAATCCTAATGATAAAAATTGCTACTCTAATTGTCCTAGCTCTTTCTCAAATACAGCTAACTCAGTAGCAAATAATCCATGTAATTGTGCAACAGGATTCCCATATATCTTAAGTGATTACAGTTCATGCACATCCTCTTGTTTATATTACAACACAAATCCTTACATCAATGTTTGTGTTTCTAGTTGCTCAAATATTATAAATGCGATTAATCCATAATCTATACTTGATTAAGGTAGATGCAATTGTAGAAATACAGCTTTTCCATATTTGAGTACAGATGGAAGTTCTTGTGTGTAGAACTGTGATTCTTAATATATTTCTATTATTGATGATATGTGCGATAATAATTGCAGCTCCTACTTTCCTTCAAATATACCAAATTTTAATGGATTAAGATGCTTTTGTAACTCTTCTTAAAAATACTTGTCTGAAGATGGAAAGAGCTGTACCAATTAATGCTCAAAATATCTTCATCCAAATTCAAATAAGCTAATTTGTATCAGTGATTGTACTAAATATGGAATGGCCAACCCTGCTTAATCGGGCTAAGTCTGCTCATGCTCAGGAATGACTCCATACTTAAGTGTTAAAAAGGATATGTGTTTATCATCTTGCCCTACAAACGGAATTTTGAGTGGAATAAATTGTTCTTGTGGAACAAATTATCTAAAGAGTGATAATTCAGCTTGCGTTGCTACATGTTCAGATTACTACCATGCTGATTAACTTTTATAATAATGTGTGTAAAATTGTCCTTTGACCATTTTAGGTTCATCTAACCCTACATCAACAGGCTAACAATGCTAGTGCCCTTCTAACAGACCTTATTTAAGGATAGATATGCAAGGAGGATATTATTGTGACAGTAGTTGTCCCAATTATTTCATTGGTAATTTTTGTGTTGATGATTGCTCAATATATGTTGGCATGACTAATCCTCTATACCTTAATTTTGAATGCCAATGCACAGATTACAAATAGTACTTAAACAGAAATACAAGATAATGTATTAATTCATGTCCTTAATATGTACACATTGTAAAAAATGTATGTGTTGATAGCTGTTCAATGATATCAGGTGCTTAAACTCCATCAAGTGGAAATATTTGTGTATGTACTGCTTCTAATCCATTATATGATTATAGTTCTGACTCTTGTACAAATACATGTAGTTACTACTTACATCCTAACCCATAAATAAAAATATGCTTTAATAATTGCCCTATTTAGCTTTTGAATTCTGTAAATCCAACTAATGGAAGTAAGTACTGCTAATGTAGTAATCCAAGTTATCCTTATTATGGTGAATAAAGTGCTTCTGTACCTTTATAATGTGTAACCTAATGCTTAAATTATCAATTTTTTAATTTATGTTTAAATAATTGCTCGTAAATTACAAACTCTTAAAATCCTGCTAATTTAAGTAGTGGGAAATAATGTATTTGTTCATCTACTACCTAATATAGAAACCCTAATAACTACTCCTGTACTTCTAAATGTCCATAATATATATCACTTAATCCCAATAGCTAAGATTGTGTAGATAATTGTTCTTAATTTACGAATGCTATTGTTCCTAACAGCACAGGGAATAGATGTCTTTGTAGTAACCCACTTTATCCATATATTAGCATTGATGGTTAAAGTTGCATTTCATAATGCAATGGTTATTTAAGTTTTAGTTCAAATAACTGTGTCTCAGACTGCCCCACAAGCTTTTAAGGTTCTATTAATCCAATTTTTCAAGGTTATTAATGCTAATGTGGACCTTCTACGCCATACTTAAATCTAAATAAGTCTCAATGTATTGCTGCTTGTAGTATTAATCAACAAGTAAATAATGGAGTTTGTGTATGTTCAGGATCGAATGTATATAAGAGCATAGATGGATAATCCTGCTTAAGTAACTGTCCTAACTACATAAATCCAAACCCAAGCATAAAAGAATGTGTTAGTGATTGCTCAATTTTTTAAAATTTTGTAAATCCAACTTAAACTAATTCATAGTGTGTTTGCCCTTCTAATTAATAATATATAAAAAGTGATTTTTCTTAGTGTTAATCACAATGTGATTAGCAATAGTTTCTACATATTAATACTAAATAACTTTATTGTATATAAGATTGTCCATCGAGTATTCCTGGATCAGTCAATCCAAGTTAGTATTATTAAAGATGCTAATGCTCTACTTAAACTCCTCTAATAAGTGCTGATATGACTTAATGCGTATCAGCATGCTCTGGTGGTTCTTTTACAAACCTTAACAACGCTCAATGTGTTTAAAGTTGTAGCTCAATACCTAATTCTATAACTCAAGGAGCTAAATGCATCTGCTAATCAAATTATTTTATAAATTTTGACTATTAAAGTTGTGTTGAAAGTTGCCCACCATACTCTTAAAATATATCAGGATACTGTAAATGCACTGTTGGTATTGATAATTCTTCTAACTCATGCATCCTAGATAAAAACTCAACTTAGAGGAAGTTATTAATTACTATGGAATTGTTTGATTAAAGTTTAGTTTTAAGACCTAATTCATAGGCAAGGAAGAATTCATCTGCTAAAAAACATAAATATTAGTTTCTAAATTATGATACCATGTTAAATAAACCTCTAAATTAAACATTAAAAGGATAATCAAATGGTAATGGTGTATAAAATAGCATTTCAAAGATAATTGATGAATAATATTATAGTAACTCAGTACAATATGATATTTCTGATTAAACGATAATTATTTAAAACGAGTCTAATGGTTAATTTAAAGAAAAAAACCGGGCATTTTCTCCTGATTTGATAAAAAATGCTTTAAACGAGCAACTTTTAAAAATTAATAACTCAAAAAATAAAATTGATGACTAAAATGAAGCATACAAAGAATCAAATTTAAAAAATTTTAGAGATAAAATGTTTTCAGTTGATTTAAATTCAATATTAAGAGAAACTCCCAAATGTAACTCTTCAAGACCAACTCCTTAAAAAAGCAGGCTATTAAGTTTATCGAAAAAGAGATAAAGTGATTGTGAATCATTAACTCTAATTAATGTAGAATAATTATGTCTTAAAGAAAAGCTCAAAAGAACGAATACAATAGGGATATCTCCATTTAAAACTACTTTTAGAGTTAAAAAGCAATATAAAACTAAATGTCCTGCAGAAATATTTAATAAAAGAATCAACCAACTCGAAGAAAAACTTAATGATAATTCATTTTCTTATTCGACTTAATTTTAAACTGAACAAAATACTTAAATTGGAAAAATAAATAATTTGAATCAAACAACTGAGGAGTAATAAAACAGCTTTTCTGAAGATTTTTTTCCTGTAAATGAAAAGGGAAAGGAAATGAAAAGTTTAGAAATAAACTATTTAGTTAAAAAGCTAAATGAATAAAAGAATTCAACAAAAGTTGATTTTAAATTCCCTCAATTTAAATCAGAAACGAACAAGGCTAATACAGATTAAAACAAGAGTAATAAATCTAAAAGTTTGGATTAGAAATCTAATACAGGATTGAAATACTCACAATGTTAGCCAATCTTATAAGTAGATAACTCCTAGTAATAGCAATCTAAAAAGAAGATTAAAAAGCACTCAAAATTGATTAATCATTAGCTAAATAATTTTAATTCTTCTTCTCCAGTTAAAAAGAACAGTATATAACTTGTTAAGGTAAACAACTCATTAGTTATATAACAGAGTCCCATATTTATGAATCCTGAAATTAAATTAAATTATTCAATATGCTATGGAAATAACTCTAATCTTATAAGAAGAGTTATGTAAAAAAGGTAACCTTTGTGGAACGAGATAAGTACTACACTTTCTAATTACTAATTTAGGTGGTAACCTACTTCTCAAGGCTTCAATTTTCATTCATCTTAAGAAAATCCAAAATATCCTAAAAAAATCGAAATTTCATAAAATTTATTTTAAAAAAAGAGTTTCTTATTATTTAATGTTGTTAATTATTGTGTAAAAAATAATATTGACGCTTTTGAATTCATGCCAATTAGTTTTTATTTTGATTTCAATGAAGAAAAATTTGAGAAAGACCTTCAGAAGTTTTCTTATTTGTTTGAGAGACTCAATTTTTACTCTAAAAGTCAGGAAAGCAAGAAAAATATTCCTTCAGACTAAGAAATAATACAAATTTGTTTAAATGAGTTTAAAGATTCAATAGAAATTTCTAAAGCAATTCATGAACAAAAAGCTTAAAATAGATTATAATTTTAACCTAAAACTACTATAGATATTGTTGAAAAACAAATATTAAAATAATTCTTGTAAATTTAGGAAACAAATTTTTTGAAAAGTAGAATGAGTGAAAATCTGCTATCAAATTTTAACATTTGGGTTTTAAAGCCAGTTAACCTGAACAGAGGTAACGGTATAACAATAGTTTAATCTCTCAAAGAAATTAATAGTGCAATAAGTGTAGGCTTTGAGTAACAAAGTCATGTAGTTTCAGATTTGTAACCATCTTAAAAGCTGTATTTTAATAGCTCTGTGCCAGTTAGTCCTGCCAAAAAGAATAAAATCAAACCTTTATTTTACTAGTTCATTTTATAAAAGTACATTGAAAGACCTCTACTTTTTCATGGATGGGTGAGAACTAGTGGATATGGTTTTGATTTAAAAACAAGTAACAAATACATTCATTTGACCAATAATGCTATTTAAAAAAATTCAGAACAATATGGATAATTTGAGAATGGAAATTCAATCAATTATGCAACTCTTAAAAAATATATTAATTCAATGAACAGCAAAGAAAGTGAAGGAGTATGGGATGGAATCTAGCAAAAAATAAGAAATATAATTAAGATTACACTTTAAGCTACTTCAGATAAAATTAATATTTTTAATAGAGAAAAATAATTTGAGCTTTTTGGCTACGATTTTATGATTGACTAGTCTTTTAAACCATGGCTTATAGAAGTGAACACTAATCCATGCATTGAAGAATCTAGTGAAGTATTAAAACAAATTCTACCTAGGCTGATAGATGACATGTTAAGATTGACTATTGACTAGTTTTTTAGCAAGCAAACAAACCAAAATTAAAGTTTTTTTCCCTTAATAGGCTACTCTAATGAGGATTCTATTTTTGAGTAATTTGAAATATGA