TTHERM_00239380

Length: 996 bp

cDNA Sequence

ATGTACAGGTCCATAGTAGTTAACAAATACAAGGATGATGATTAGATTACCATCGAAGATTCCTCTTTAGATGAACTAAGAGAAGAATTAAATGATAAAAATTTTTTAGTTAAGCTTCATGCTGCTCCTATAAACCCACTAGATTTGCTAAAGTTGAATGGGCATATCTTTTCGTACAAACCTCCATTCACACCTGGCTCAGAAGGTTCAGGAGTAATAGTTGAAGCCAAAAATAAAGAACTAATAGGAAAGAAGTTATCTTTCATCTCTCCGATAGGTTCATGGAGAGAATACTCTGTAGTTTCTGAAGAAAATGCCATTTTGTTAGGAGATGATGTGGATCTAGATTCTGCTGCATGTGGATTTATTAATCCATTAACATCATAAGGCTTAGTTCTCTAAGCTATCAACCACAATGCTAAAGGTATTGTCAATTTAGCTGCCCAAAGCACTATTGGTAAGATGATTAATGATTTAGCATTTGTTAGTGGGTTGAATTGTTTAAATGTAATAAGAGGAGATCAAAAAAGAGTTGATGAGCTCAAGGAGTAATATAAAAACTAAAATGTTATCACTTTAGACTAAGATCCCATAGAATTTTAGAAATAAGTGAAAGAACTAAGCGAAAAATTATAGGCTACTGTTTGCTTAGACCCTTTAGGAGGTCCTGTTTCTGGCTAAATCTTTAACAATCTTCCAACAAATAGCAAATTAGTAAACTACGGATCTCTAAGTGGTAAAGACATAGAGGGTATTAATCCAGTATAGCTAAGATGGAAACATAAATCGATAGTAGGTTTTGATATATTTAGTTGGTATGTAGGTTTAAAGCCTGAAGAAAAGAAAAAATCAAAGAACATTGTCAGATAACATGCAAATACTATATTTAAAATCTAAATTGAACAAACTTATAGCTTTGATTAAGTAAAGGCAGCTCTAACATTATTCAGAAGCTTGAAAGGAGGTAGAAAAATAATTTTAAAACCATTTATTTGA