TTHERM_00242100

Length: 429 bp

cDNA Sequence

ATGGATATCATAAATATATCAGTCAACAAAAAATTAGCTAAAGACAAAGACTTTTAGTTTTTAGTATTGAACATGCTTATTATTAGGAGATTGATGAATCTTGATAATGATATAACTCAAAAATATATACAATGCTATTAAACTCCTAGAGGTGAGAGAGAGTCAACAGATAAGTATGTAGCTAATGTAGAAAAATGTTTATTAAGTCATAAAAAATAGTTTGATTTTACTCAAAGTAAAATGGAAGAAGTAATTAAAAACATTGAATAAGCTAAGGATAATTATAGATCCAGAGATATTAACTGCTTCAATCTTGTTGGTGAAAGTGAGCTTAAAAATTGCAAAGAAGTAGAAAAAAGAAACTATTTGCTTAAGATCAAATCTATTTATGAATCAGTCCCAGAGTTAAATAGCATAAACAAGCTATGA