TTHERM_00245080

Length: 738 bp

cDNA Sequence

TAACAATTAGCATAAAAATAATATTAAAAAAAAGAAAAAATGGCCGAAGAATAAGGTGATAACTGGTTCCCTCTTGAATCAAACCCTGATGTTATTAATCCTTACGTATAAGGTTTAGGATTTGACACAGCATAATATTCATGGTGTGATTTACTTTCAGTAGAAGAATGGGCTTAGGAAATGGTCCCAAAACCATGCTTAGCAGTTGTTTTCTTGTATCCAATTAGCGAAAATACAACAAAATATGATCAAGAAGAAGAGAACTAAGAATAATAGGTTCACCAAAGTGTTTATTTCATGAGACAATATGCTAGAAATGCTTGTGGTACAGTTGCAGTAATGCATGCTATGTTAAACATCGATCCTAGCTTAGTATCAGCTAACTCTGTTGTAGATAGATTTAGATAAGCTACTAGAGAAATGACTCCTGAATAAAGGGGAAATTACTTTTTGACATGCAATGACTTAAAATAAAATCATTAACAAGCTGTTTAGTAAGGTTAATGTAGCATTCAAGAAGAAGTTGATACTCATTTTATTGCTTTTATCCAAAAAGAAGGACATATTTATGAGTTAGATGGAAGAAAGAAAACTCCCATTAATCATGGATAAAGTTCTCCTGATACTTTCCTTCAGGATGCTTGTGTTGTTGCTAAAAAGTTAATGGACAGAGATCCTAGCTAATTAAACTTTACTTTGGTTGCTTTAGCAAAAACACAAAATGAATAAGAGTAATGA