TTHERM_00245200

Length: 1713 bp

cDNA Sequence

ATGAATCAAGGTTTTGATTATTTAATAGTATTAACATCAGGTTAAACAAAAGAATTGGAGAGAAACAATTAGGAGGAATAGAAATAGAGCACAAGCAACAATCTTTAAAATTAACTCCAAGAAGATAATGATTCTACTGAGTAGCTTGGAAGGATGATAGAGTTTAATTGGTGCATTTACGATACTAAAAAGTAAATCGTCACTGAATAGTTCTAAAGATTCATCAAGGGAGAAGATTTCTTAGTTAATAATGAGACTCTTACCAAAAATAAAATCACTCTTAGCAAGTTCGATGGTGCATTGCTATTTAGCAAGCTTATTTAGGAGTTTAATGATTACACATATACTAATTTCACACGCTAAAACAAGAGTTTCTGCATAGTCACTTACGGAGATGCTCTCATGACTAGAATCTTACCCAGAGAAGCTTAATTTAATCAAATGAAACTTGCTTCCCACTTTTTCACTTATTTTGACATAAGAAATGAATTCAAAAAGAATTTCTCTCATGCCATATCTATCAAAACACTACATGAAATGTTAACATACACTAATCTCCAAGAAAAACCACTTTTAGACTAATCTATAGGGTAATTTGAAATGAGCAACATAGTAAGATTAGTAAATATGCTTGTAAGAAGCGGATATGTCTTCAATCATCCTAAATTGATCAATAACTCTTATCAAGTTGTGTTAGACAATTAGGACTCTAAGACTAGATATATTCAATCAAGAGAAAAGAAGTCAAAAAATAATTATGTCAGAGGCAGAAGCCCTGAACCATTTAAAAACCTTTCACAATAACATTTTATTCGCATAAGAGGCCTTCCTTACTCTGCAAGAGAACCTGAAATCTACGAATTACTTAAAAATATTAGGATTTATAAAGAGGATATTGCTTTTCTTTATGATAGCGAAGGTAAATTCTCTGGAGAAGCATATGTAAGAGTTTACAGCTAGCTAGATAAACAAGAAGCTTTGTGCTACAATTTAAATAAGGTTGAAGGAAGATTTGTTGAGATTTTCGAAACTACAGAAAATGAATTTAATAGAGCTAAAATTTCTTAATTCCCAGAAAAGAGAAATCAAGATGATGAGCTACCAAATGAAACTCAATTTGATCTCAATAAAATAGTCACTGAAGGAGCAGGAGTAGTAAGAATTAGAGGCTTACCCTACTCTTGTACTGAAGAAGATATTAAAAAATTCTTTAAAGGATTAACTATTTTACAAGGAGGTATTAAGAGAGCTATTCTTGGTGGCAGACCTGGAGGAGAGTGTTTTGTAATATTTTAAAACAAGGATGATGCTCATAAAGCTCTTAATTTTCATATGGAAAAAATTCACAACAGATTTATAGAAGTTTTCTTAGCCACAGTTAAGGAATTCGAAAATTATATGGCACATAACTTTGTTAATTCTGCTCCTGTTTATAGTAAAGATAACATGCCAAATATTCCACAAGAGAAAAGAAAATCAACTCTCATGGTTATGGGAATGCCTTTCAGTGTAACTAAATAAAAGATTTTAGAGTTCTTCAAAGGATTTGACATCAATGAAAGAGAAATACATCTTCTTTGCTCTCATACTGGCAAATTTAGTGGATCAGCTCTCGTTACATTCGAAGACGAGCTTGAAGCCCAAAGAGCTCTAAAAACAAAGAATTTCTCATATATTGAAAATAGATATTTAGAATTATTTGAGTATAAATGA