TTHERM_00245410

Length: 1131 bp

cDNA Sequence

ATGAGTGACACAACAACAACAGCAAATTCAAAGAAAAACACCAAAATAAATGGTAAATAACAAGGTAGTAAAGATAAGGCTGAGAAGAAAGAGAAGGCTATTAACAAAAAGAAATATGAAAGCGAAGATGAAGAAGAAGAGGAAGAGGAGGAATTCTACATTGTAGAAAAAATATTAGATTATAAAAAGATAAAGAATAGAGATCTATTTTTAGTAAAATGGGAAGGGTACGAAGAGCTAACTTGGGAACCCAAATCTAATTTGTCAAATGTAAAGCAACTTGTTGAGAATTTTTTGAAAACCTTAAAAGATAAAGGAAAAAAAGAAAATTCTGAAAATCTTGAAAGCTCGAGTGCTTTGCAAGAAGGGAGTGAATCTAAAAAGCAATAATTAAGCGGTGGAAAGATATAAAAAAAAGAAGTAAAAAGCCCTATATCTATTAGCAAAGAGAAATAGGCAGAGAAAGTAAAGTAAGATGAAGGATCTCATTTAAAAAGAGATGTAGAAGATCACCATAATATTTCTATTTCTTCAATGAAGGGTAAAAAAGATGATGATGGAGAGTAGAATGAAGAACAAGAAAACAAAGTTGTTGTTAAATAAGAAGACGTAGATGAGGAAAAGCAAAGCACCAAGAAAAGAGGAGAAGAAGAAGAGGAATAGTAATAATAATAAAATAGTAAACAAATAGAGGAGGAAGAAGAAGGTAAAGATGTATAGAAAGAAAAGAAATAATAGAATGAAGAAAAATAAGATATCAAGCACTTAGAATAAAAAGAAAGTAAAGAAGACCACGATGCTATATAATAATAATAAAAGAACACTAGTCTCAATAAAAAAAGAAAGAAAGAAGAATAAAGTTAGGATGATATTGATGAATAAAATGAATAAGATAAACCACAAGATAAGGTAAAACACTTACCTGAAATTTTAGGAAATCTTGAAGAACACATTCCTTTAGAAATATCTAAAGCTGTCTATAAAACATCTAAGTTTTAGTATCTAGTTTAGTGGAAGTAGCAATAAGGCATTAAAATTATACCCAGTTTTATTTTCTCTGACGATTTATTAAAAAGATATAGTGATCTCATAGTACATTTTTATGAAGACAAAGCCTTAAAAAGAAAGTGA