TTHERM_00245660

Length: 1860 bp

cDNA Sequence

ATGGTTAGGCAATAAAATAACTAGAATACACAGAGTTAAAGCAATATCACAACCAGTGTTAGTCAATATACATCAGAAGATTCCTAAAATTCTTAGGTTCAAAGAGAAAACAGGAATAAAATAATCTTAAAGTATGATGAAAACATTGCCAAAATAGTTGCTTTGGGCATGGAAGAAAAGCTCATAAAAAATTAATTGGGAAAAATAGATATATCAGATGCACTTGTCAAAGTGAGTAGTAATGTTAACATTTTTAGTGTTAAGTAGAGTGCTAATTTTTTGTTTGCAATATCTAAATTGATAAATTATGGATATCTCTCGCTAAATTAGGAATTAAAAGATTTCTTTGCAAGATTTAAAGATTAGATTATGAAGTAGTAGTAGCAGTAATAGTAAAAAGAAAAGTAACATAGATCTAGCAGAAAAAATTAGACTAAAAAAAGACTCAGAGACGCAGCAAAGGAGATAGCTGATAACTTAAGCAACAGCATTGATGAAAGATCTAACACTTCTATTTAGTAACCTAGACATATTTCTACAGAAGAGAGACTGAATATGCAAGAATAGAATCTGATATCACCTCTCGCTATGATGATTAATTAAAGATCTGATTTAGATTCAGATAATGAAAATTCAAATACAGGTTTTAGCGATAATTTACCTGATCCTAATTAACAAAGACTTATGATGCTTGGAGAGGATAATTTAGCTGGGATAGAATTTGATGGGGGACTTGGCATGGATACAGGTTTTGATTATGATGGATTTTAGTATGATTTTAGTGAACAAGATAGTTAAAGCTAAGGATTCAATAAGGTTAATGGAAATGCTATAAATATCTCCCAAGAATTAAATTAAGTTGGCGACATCTCTGAAAGATATATAAGAAAAATTACCAATTATGCCAATTAACAATCTTCAAAAAAGAAAAAAAAAACTAAACAAAAATAATAGGGACATAACAAAGAAGGCGAGCATGCAATTCTTAATGAAACAGTAGATATGGATAATTAAGAGTTTTCAAAAGCTATGGATGAAAAATTAAATTAGTTCTATAGTAGCTAATCATAAAGAGTTAATAAAAATATATCACATATTTCAGATATATCTAGATTATCGACCACATTATAATAGCCATCAATATTATCACAAAATTTTAATATCTATGAAGAATCAATCAGCGAAGCACCTTTCTAATAAATTAATATATCGAATTATTTAAATGCTTCCACCCTAGTTGACTAACCAATTTTGAATCTTACTAAGAAATTTGATGAAGCAATAAGCCTAAAAGAAAATGATAATAATGTGCTCCTTTCTGAAGAACTTATTTCTAAATTAGAAAAAGCAATGCAAAATATAAATATTGATTTAGTAAAATAAGACTAAGGTGGAGTGGATATGATGGATTTTAACTAGGATAACTAAGGCGGCTACATGGATTATCCTGATGATTTTGGTAGCTTAGATTAATATAATCAATAAAAAGAAGAATAAGATGGAGAACTAGAAATTCCTGTTCAAATACCAGAAATATAAAAATCTAAGCTAGAAAAAGATAAAAAAATTGATGAAATTGATAGTTTATAAGACTTTGATATTACTCCTCTTGATAAAAAAATTCTTACAGAAGAGGAATAAAGAGTTCTTCAGTAATATGACAAATTATTCACAAAATTAAGAGATATCCTAGACAAAGAACCAACTGCTGAGTTTAACGATGTTTATTAATCATTCAAAAACTAAAAGAGTAAAGCAGAGCTCTTCTACGATATTTTGGAGTTATAAAAGCTTGGTCAGATTTCTGTTTCTTAAAACGATAATATTCATTTTTCACCAATACAAATTCTTATCAAATGA