TTHERM_00248520

Length: 1932 bp

cDNA Sequence

ATGGGTTAAATTATTCATGGCTCCTACTAGAGCTAATAAATATAAGAATTTTGTGAATAGAATAGCATAGATATTAACATATTTTAGAATTAGATCAAGTTTTTAAGTTAAATGAAATATTAATATGTTGGAATATTAGGAAATGGATTATTTGGTTAGCAAATACAAGCATATTCTGAGAATTATTAGAGTGTAGCAATTAAAATAATTTATAGCAAGAACTCTGGTTTAGAAACAGCTCTTAAACAATCAACAAAATACAAATAAATAAAAAATACATAACATCTTGCGCAGATACATGAAATTGTATACAATCCTTCTTTAAACACTTATTACATTGTGTAAGAGTTGGCTGATTGCTCCCTTAAGGAAATTCTTGAAAGTTGCAAGCTAACAGATAAACAAATATATGAAACTACACTGCAACTGTTAGAAGGTTTAGCAGAACTTGAAAATTTAGGATTAATACATGGAGATATCAAGACAGAAAATATCTTATACAATAGACCTAAAAATAAATTTATGTTTACTGATTTTGGTTTGGCTCAAGTTTTAATGAAATCTAATAAACCTGCTTCATCTAATTCCAAACAACTATAAAGAACTTAAATTTATGGTGCTCCAGAACTAGAAAAAGAACAAGATACTTCAAGATTTTAAAATAAGATGGATACATATGCCCTTGGAATGGTTTTGTCTGAAATAATTATTGGAAAAGGATTTGAACTTGAGGAATCTATCGATATCAAAAATAATAATGACATACAAGACTACATACCATTCGACTCTCATCATAAATTTTACATAGAAAAGATTATTTTAAATATGGTGAAGGTATCGAAAAAAGAGAGATAAGAAACTAGTGAACTGATTAACACTCTTAAGAAAAATTTTGAGTTTAATGAATAAGATTTAATGGCTATTTATATAAAAGAAATATCAAAGCTTCTTTAAAACTAACAAAAAATTAGCAAAGACTATCAAATGTATTATCAGAAGTATTTTTCACAAAGAAACTTATAAAAAATAAGTGCTAACGAATCGAGAACATAAATAGGTGATGGATAGTTATATGGAATAATTGATGCCATCAAATTATGCAAGAATATTTAAGAGCTAGAATTACAATTTTATGTCAATTTAATAACAGATAGTGGATTATTTGCAATTACCAGCTTGGTTAATGATCATTCCAAGTCTTTAGAGATATTAACTATCAATTTTGAGTAATTTAATATTTTTACTAAGGTTTAATGCTAACATTTTTCTGTTATTTAGAGAAAACTAAATTAGAGATAGAGGCATTCTACAATTATTTCAGTCTATAAATAAGTGTTTGCTGCTGAGAAAACTTTCTCTTAGTTTCACCTAATTCGAGTTAAATTTAATTGCAAGAATTAAAGCTACATTTCTCTGAAAATTAAATCACAGGAAATGGGCTAATAGATGTATTAAAGGCTCTTTAATAGCAAAAGAAACTTACAAGTCTTTCTCTGTATTTAGCAGATATTTGTATCAACGATCAAGATTTCTACGGTATTACAGAAGTGTTAACCAATTTTAAGTAATTGCATGAACTCAAATTATGCTTTTAGAGAAACGATTTAAGTAGTGATGGGTTTAAAGGATTGGCAGAAATATTTAAAGATAATATTTTATTATAATCATTAGAATTTTACTTTTAGTAAAATAAAATAGATGACTAAGGACTAATCTCTGTTGTAGATAAATTATAATTCTGTTAAAAGCTATAATTAGTAGAGCTATTTTTTTCAGAAAACCGAATTACCGACCATGGGCTTATAGGCACAGCAGATTCTCTTAGAAAATGCAAACAATTAAAGGACATTTATATAGATTTTAGTGAAAACAAAATTTAAGAAAAGCAAAGGATTTAGTAAATATTCGATGGTAATTTTAAAGGCAAAATGA