TTHERM_00257170

Length: 2040 bp

cDNA Sequence

ATGCAAAAACCGTTTTGTTTGAGTTTGATTTTGGAGCTAAATAAATACATTTTATAAGATTTGCAAAATAAAATTAGCTAATTTGTTTTATTATGTTTAACAACAATTTAGGAAGATGAAAATAAGTTAATTAAAGAGCACTTCAATAAGCCTTTAAATAGCTTTGGGAAAAAAATAGAAAACTTTCAAAATGATTTGGTTAGCGAACTGAAGGATTAAATTATAAAGATTGAAGAAAAGGATGGCCAGAGGGAGTCTTAGATTTATGAGACTTTATCAGCATTTTAGAAGAATATTAACGATTTTGAAGTTAGAATTGAATAGTTTGCCAACTAGCTTTCAAAAGACATGGCAACAGATATAAAAATGTTAGCTACTCAAATCCAAGGTGAAGCAAACAGCTAAAACACAGCATCAATTTAACCAGATTAGCTTAGAAATTTTCCAATTGTATCTGACAATCAAGTCAAATAGAATTTAGATAAATTCAGAGAAGAAATCAATAAAAAAATTGAATTTGTTTTAAAGGAAATGAGAAAGAATGCTCTTTTAACTGATGTTGAGTGTGTAGAAACTAAATTAAAAAAAGAATAAAAAGAAAGAACTTATTTATGCAAGTTTGTAGAAGACCTTACCAGAAAAATAGACGAATTACCTCAATCCATTACAACCCTTATTAAAATTATTCTTTAAATTAACTTAGGTGCTAGCACTTCAAGAAATGTCTCCCCTTCAGCAGTTTAAGAATCAAATTAATTTAAATTAGTTAAGTAAATTGAAAGTGATATTGAGGATTTAAAAGAAGTAGTAAATGCTTTAGTCGATAAGATTGAAGAATAAGATAAGAAGAAAAAGTCTTCATTTATAACAAAAGACTAATTTGATAGCTTAGAGAAAAATTTGACATTACAAATCTCAAGATTTGTTGATCGTTTTTAGAACTTTTAAGCAAACCCTTCATAAAATGTTGCTTATGATGAATCTTTAAGGGAATCTGATAATTAAAGAAGTAATAATAATTTCTCAGCACGACAATAATACTCTACATTAAAGAGTGATTAATATTTAACTTAATAAATGAGATCTCCTTAGTTTGAATAGCAAGGATGGTAGTAATAATAAATGTTACAGCAAAATTAGTATTAATTAAATAACCAAAGTGCAGAAATACACCCTGAAGACGACTCTTACATGATGCAATAAAAATATTCTCCAATAATTTAAGACGACCAAGACCTAAGGGATACTCTGATTTCTAAAAAAGATAAAAACACATCATTAAATAACTAATAGTCAGGTGGAGATAATAATTTAGGAGAAAGCTTTGGGTTAAATTAAAATAGTCATATTTCTAACAATCTTTCAGATAAATTAGATTAAAATAAAAATAAATCGAGAAAGAAATCTAGTAATTAAGAAGAGATTCTTGATTAATATCCATAGAGAGAGAAGAGAGGAGTGGCATCTTCTAGTTCTAAATCAATAACTAGATAATCAGATAAAGAAAATAAATAAAATTCTAATTCATAGAACAGAGGTAGAAAAGCTACCGACGAATCAGTCACTACACTTAAAAAGAATAAAAAAAGAGAATTAAAATCTGAGTCCAAATCTATGTCAAAAAGTCCTTCGAATATAGGAGAAGTTTCCAGCACTAAAAGCATTAATGCTTCAAGAAAATTATCCTAACAAAATATATCTATAGACAGATAATCTAAATCTAACACAAGAGTAACATTAACTGAACCTGAAGAAACTCGTATTAAATCGCCTCTATCTAATATATCAAAAAATAAAAGTGGGTTTGAGTCAAATCAAAAGTCCAAGATAAAAAATAAATCTCCTTCTCCTATAGGTAATACTAATAAATTCGCTGAGAAGAAGAGACAAAATGGAGAGAAAATAAAAGAGTTATTCAAAAAAAAGAAGTAGATGGATTAAAATAGCTCTTCTCATACTAATTAAAATCACTCAATATCTTAAAAATCAGCCAATATTTCAGTAAATGAAAAAAAATAAGGAGATAAAAAGAAGAAATGA