TTHERM_00275740

Length: 5337 bp

cDNA Sequence

ATGCAAGGAGGCGTTCCTATTAGAGTTTAGACAGTTGCTTCCCTAACCCAATTAGGAGTTGGTTCTGAATATCTTAAGTTCAATTAAACAAGCTTTTAGTCAGATAGAACTATTTGCATTAATGACAAGAATGCACATTTAAAGGAGTAAGAGCCTTACCATAAACCAGTTGAGCTTTAAGCTTAGCCCAAAAATTAAAGAATTATTTTGTAAATAGTTGACAACAACTTCAGCGTTAATAGAAAACCCAATAAAGCTGAGTACAGTTTAAACCATCCTACAAAGAATATCCTTAGTATGAGAGCTCCTAGTCCCAACGGAGTAGGCTGTTATGTTTAAAGAGGTGAAAAATTCTAAATATTTTCATCTTTTCTGCTAAAATAATCTCTTTTTTTTCCATGTTTTCAAACTCTTATTAACGGTGTTTAATAAAATATAAAGATCTATAACTTAGACAACAGAGAAAAGCTAAAACATATTGATTTAAATGAAAACATTGTCTATATGACTTGGGTTAACAATAACATATTAGCAATGGTTACTCCCACCAAGGTTTATCATAGTGATCTTACTTCCCAAGCTCCTTCAACAGTTGCTTTTGAAAGAGCTGGTAATTTAGCTAACCCCAACTGTTAGATTATTGGTTATAAAGTTAACACCTAAGGTAATTGGGCTGCCTTATACGGTATCTCTTCTCCTGATTAGAGACAAATTAATGGTGATATTCAATTATATAAGCTTGATGAAAACAGTTAATAACCTTTAACTGGTCACTGCTGTTGCTTCGGATAGGCTAAAATTCATAATGATACTCACCTTTCAGATATTTTTGCTTATTATGATAGAAAACCTGGTGACACTGTTGCTAAAATTCTTTTAAGAGAATTATCAGCTCCTCCTGAGGGTTTCTAAAAATATAAGGGAGCTGCTGAATATCCTTTCAATGCCTAATTCCCAGCTGATTTCCCTATTTATATGTAAGTTTGCACTAAATATGGTTAACTTTTCTGCTTGAGCAAGAGCGGTTTCCTCTTTGTTTATGAATTGACTACCAGCGCCCTTATCTATCAATAAAAGGTTACTGATTCTTCTATCTTTGTTGCCACTCAAGACTCTAAAGAAGATGGTATCTATGCTATTGCTAAAAACGGTAATGTAATTCTTATATAAATTGACCCTTCTTAACTAGTTCCTCACCTCTAAAGATAATAAAATATTCCTAATGTCGTCTAAGTTGCCTTCAAGCTTGCTTCTAGATATAGACTCCCTGGAGCTGATGGTATGTTCATGGATTAATTCAATAGATTTATGATGGCAGGTGATTACGCTAACGCTGCTTAAATTGCTGCTGGCGCTCCTGGTGAATTAATTAGAAATGCTTAAACTATTGCTAAATTTAAATAACTTTAAGGCACTCCCTCCCCTCTTCTTGTTTATTTCTAAACTTTAATCTAAAAGGGTACCTTAAACTAATTAGAATCTTACGAACTTGCTCAATTCCTCTTGAGCTAGAACAAAATGACTGCAGTTGAAAAGTTAATGAATGAAAATAAGCTTGAATACTCTGAAGGTTTGGGTGATTTGATTGCCACCTAAAATCCTAACTCAGCTCTTGAAGTTTACAAGAAATCTGGTTCTCACTTAAAGGTTATTTCTACCTTAGGAGGTTTGGGTCGTATTGATGAGGCTGATAAGTACGCTCGCTTAAATAACTTAAGCTAAATTAACTACACTGAAGTTATTAGATCCACTGTCCTCACCAACCCCTAATAAGCAGTTACCCTTGCCAAGACTTAAGTTGCCACTAATCCCAGCACTAATGTTCATCAAATTGCTGAAATCTTTGGTTAAGCTGGTAAGTTCAAGGAAATGAGTGCATTCCTTGTTGACTGTATGAAGTAAAACAGACCTGAAGATGGTCCTTGGTAAACTAAGGTCCTTGAATGGAATATCATAAATGAACCTAACATTGTTGACCCCATTTTCGATTTAACCAAATGGAATCAATACAACAGATTACGTATTGCTTAACTATGTGAATAAAAGCAACTCTACTAGAGAGCCCTTGAAAATTACTCTGACATCAAGGACATCAGACGTGTCTGCCTTAACACTCATATGATTCAACCTGCTTGGCTCGTTAATTATTTCAGTAATGTCCAAACTGATTGGGCTCTTGCTTGCATGTAAGATTTATTGAAACATAACAGATAAAATCTCCCATTAGTTGTTGAAGCTTGTGCCAAGAACTATTAAAAATTCACTGTTTAAAGCTGTATCAAGTGCTTCGAATCTGTTGGTTCATTCGATGGTGTCTATACCTTCTTAAGTTAAATTATTAACTCTACTGAAGACAAGGATATCCATTTCAAGTATATTGAAGCCGCCACCAAGTGCAACTAATTGAGAATTGTTGAATAAGTTATTTAGGAAAAGGCTAACTGTTATGATCCCGTTAAGGTTAAGGATTTCTTAAAAGGCTTACGTTTACAAGATCCTAAGCCTCTTATCTTCCTTTGTGATATTCATAAATATATTGATGAATTAACTGCTTATCTTTACCAAAACAATTTCTTGAACTACATTCAAATTTACTTGTTCTAAGTCAATCCTCAAGCTGCCCCCATTGTCTTGGGAACTTTGATTGATCAAGAATGTGAAGAAAGATAAATTCAAATCATTTTACAACAAATTGCTGGTAAATTGATTCCTTAATGCTACGAACCCTTAATTGAAGAATTCGAAAAGAGAAACAAACTCAGAGTTCTTGAAAGCTGGCTTGAAGGAAGATGCAACGAAGGAAACTAAATTCCTGCTATCCATAACGCTTTAGCTAAAATTAAGATTGATACCAACTAGGACCCTGAAACTTTCTTACAAAACAACCAATTCTATGATGCTAAGGTTGTTGGTAAGTTCTGTGAAGAAAGAGATCCTCACTTAGCTGTTATTGCTTACAAGAGATCTTGGGGTCAATGCGATGAAGAATTAATTATGGTCACTAACAAGAACGCTCTCTTCAGACTTTAAGCTAGATATTTGGTTGAAAGACAATCCAAGGAATTGTGGGCTAGCGTTTTAACTCCTGACAATCCTTACAGAAAGTAAGTCATTGAATAGGTTGTTTAAAGTGCTCTTCCCGAAAGCAAGGATGTTGACTAAGTTTCTACTGCTGTCAAGGCCTTCATGGATGCTGAACTTCCTGAACATTTAATTACCTTATTGGAAAAGATTGTCCTTCACAACCACGAATTCGGTCAATACAAGAAGCTCCAAAACTTATTGATCATCACTGCTATTAAGAGTGACAAGACCAAGGTTATGGATTACATTAACCGTCTTGATAACTATGATGGACCCGAAATTGCTAAGATTGCTTTGGGAGATCCTTACTAACTCTATGAAGAAGCTTATATTATTTATGTTAAGTTCAATCAACCTGTCTCTGCCATTGAAGTCCTTATTAACAATATTGATGACATCCCTAGAGCTGCTGAATATGCTCAAAAGGTTAACAACCCTGAAGTATGGAGCAAAATTGCTAATGCCTATCTTGACCGTTCCCAAATCACTGAAGCTATTGATTCCTACATTAAGGCTAAGGACCACACTATGTACCTCCAAGTCATCAGTGCTGCCGAAATCGATGGTAAGTTCGATCAACTCATTAAGTATCTCTTGATGGCCCGTGAAAACATTAAGGATGCTTAAATCGATAACGCTCTCGTCTTTGCCTACGCTAAGACTGAAAAGATTACTGATCTTGAAAACTTCATTTCTAATTCCAATTCTGTAGATTACCAACGTGTTGGTGATCGTTGTTACGATGAAAAGCACTATGAAGCTGCAAAATTGCTCTTCACTGCTACTAAGAATAATGCCAAGATTGCATCCTGTCTCGTTAGATTAAAACAATTCTAACAAGCTATTGATGCTGCTAAGAAAGCTAATACCCCCAAGACCTGGAAGGAATTAACTATGGCCTGTGTTGAAGCTGCTGAATTTAAACTTGCTGCTGTTGCAGGTCTCAACATTATCATTCATCCTGACCATCTTGAAGAATTAGCTTAATACTATGAAGAATTTGGCTACTCAAATGAAATGATCTCTTTACTTGAAACTGGTATGGGTCTTGATCGTGCCCACGTCGGTATCTTCACCGAATTAGGTGTCCTTCTTGCCAAGTACAGACCTGAAAGACTTATGGAACACTGCAAGCAATACTACTCTAAAATGAACATCTCCAAATTACTTAGAGTTTGCGAAAGATACTAACACTGGTCTGAAGCTGTCTTCTTGCACTCTAACTATGATTAATATGATAACGCTATCAACATTATGATTGAACACTCACCTGTTGCTTTTAATCATGATCAATTCGTTAATCTTTTAATTAAGGCTTCAAATTACGATTTATACTATAAAGCTATTCTCTTCTATTTAGACGAACAACCTGAATAAGTCAACGAACTTCTTAGATCTCTCACCACTAAGATTGACTTGAGCAAATGTGTCTCTGTCATGAGAAAGACTGGTTATATTGCTTTGATTACCCCCTTCTTAAAATCCGTATAAAATGCTAATAACAAGGAAGTTAATGAAATCTTGAATGAAATCTACTTAGAAAGCTTCGATTACGAAAATCTCCGTCAATCCATTACAACATATGAAAACTTCGATCAACTCACTTTGGCTTAAAATTGTGAACGTCACACTTTATTAGAATTCAGAAGAATTTCTGCTTATCTTTACAGACGTATTCAAAAGTACGAATTCTCTATTGCTCTCTCTAAGCAAGATAACATTTACAGAGATGCCATCGAAACTGCTTAAGAATCTGGTAAGGTTGAATTAGTAGAAGATCTCCTTAAATTCTTTGTCTAAAAGGGTGAAAAGGAATTCATTACTGTTACTTTATATACTTGCTATGAATTAATCAGACCTGATTTGGCTATGGAATATGCTTGGAGATTTAACTTATTTGAATTTATTATGCCTTACTTCATCTAAATTACTAAAGAACTTACTTCTAGAGTTGATACAGTATAAAAGAAGCACGAAAAACGTGAAAAAGAAGAAGAAAAGAAAGCTAATTAATAATTAAACTAAGGTATGTTCATGCCTACACATGATATTTTACCAACTGCACTTATGATTGGACCTCCTCCCGGTTCTATGCCTGGTATGAATATGCCTCCTATGGGTGGTATGCCCCCTATGGGTGGTATGCCTCCAATGGGCGGAATACCTCCAATGGGTGGAATGCCTCCAATGGGTGGTATGCCTCCTATGGGTGGTATGGGTGGTTTCGGTACAAACCCCTTCGGTCCTTAATGA