TTHERM_00276050

Length: 1059 bp

cDNA Sequence

ATGGGTGAAAAGAAGTACATTTTGGTTTTAGGTGGTTCCACTTTTATGGGTTTACAATTGCTTTAGAATCTATGTTCTAGCGAAAACGAAGACTACGAAGTTTATTACATAAATCGTGGTAAAAAATATTGGAATAATTAAGTTAAAAATATTAAAAATGCTCATCATATCTTCGGAAATAGAAAAGAAAAATAAGAATATAGAAAGCTTATTGAATATGAGAGTAAAAAGTTAGGAATTGATGGAAAAAAGAAATGGACAGCAGTTTTTGATTTTTGTGGCTTTAAATATTCAGAAGTGAAATCAGCTTATGAAGCCTTAAAGGGAAAATGCGAACTATATCTATTCATCTCTACTGATTCTATTTACGATGTCTGCGATAAATCAGTCAGGAAAGAAGGATAACCAATTAAAGAAGAAATGGCATGTAGACCTAAAACTTTGACTAAATAGGCAGAATATAAAAAGGATGACGATTATGCACATCATAAGCTAAAATGTGAGGAATTTTTATACAATTATGTAGAAAAAGAAGAATTACCATTTGTTATTTTAAGATTACCTGATGTCATAGGTCCATTTGATGACACTGGAAGATTTTGGGCTTACATGAAATGGATCACTGAATTCAATAAAAACACATTATACATGGACGATGAAGCTAATAACTTAAAAATGAGCTTTGTTTATAGTTAGGATGTTGCAGATATCTGTTTAAAACTTATAAATATGCCTAAAGATAATATACTACATAAGAGTTATAATATTGCATGTGAGGAAGTGATAACTTTAAAGTAAATGATAGAATAAATCGCTAAAATTATGGATATAAAGTTGGTTAACATAAAGAATACAGATAATGCATCGAAGTTTTATCCATCTGTTGACTGTGGCCCTATTGATATCACGCTTGCTAAATAAATGCTAGGATGGAATCCTACACCATTAGAAGAAGTATTGGAAAAAACAGTAACATTCTTTAAGCAAGCCAAGGGCAAATATAGAGAAGAAGAAAATTATGCAGAAAAGAAGCTATACAAAAAAATTAAGACAGATTGA