TTHERM_00283340

Length: 1017 bp

cDNA Sequence

ATGTAAAAATTGAGCCCACTAGATCAGTTGGATCCTAACAATGTTGGTGGAAGAGAATAAATGATAAACAGGATGTATAGTCATCAAACAGCACTTTTAAAAATTAAGCCAACATTAGATACAAAAAAGCCACCAAAACCGCATGTTGATGCAAATAAAAAGGATAAACCTCCTTTGAAATATAAAAAATTATTAGAATATGGAAATGTTTATAAAACATTCAGTGCAGTTGTGGGAGCTTCAAAACCGTTAATTGACTCAAAAGAACCAGAAACAACTAAATTCAAATCATTTTGGGGAAAGAAAAATAAAGCATAAAAATTTTAAGAAAAAGAACATGAGCTTAACCTAAGAGCATAATAAAAAAGAATATAAGGAATAGGTTCTATGTAAGAACGCAAAAAGAATCCTAACGACCCACTTGCTCATCCTACATACCTATTAAGCTCTGATCCCTAGCCAAAAACTAATAATTATTTATTAAAGTAAATACTTAAGCCTTAAAAGACAGCAAATTAAATCGATCTCAGCAGACTTTACCCGAAAAAGGAAAAAAAAGAAAAGCTATAACCTGAAGGAGGTTAGGATTAGGTTTATTAAGAATTTAGCTTTCGTCCTCAATCAGCAAAGCCTGTTGAAAGATCCAGTAGCTATATGAAAAAAACTGATGGAAAAAAAGAGCCCCCCAAACCTGTAATTGATAAGAGCAAGAGACCTCAAACGGCTAAGACTATTACTAAAGAATAATACGAATAATATAAAAAAGAAATATAAATGAAACAAAGTGGTATTATCGAAGTAGATTTTGTAGATGAGATCCCTAAAGCCAAGGGAGTAAAAGAAAGTGATTATGAATATATAAAACAAGCCCTCATATAGTTATTAATTAAATACAGAATATACTAAGAGAGAGACATGAAAATTCTGTTTGGTCGTACAGTTGTTCATAATTAACACATGAAAATGGATAAATTAGATTAAATATTTGAGGAAATAAAATCAGAACTTGATAAATGA