TTHERM_00283890

Length: 702 bp

cDNA Sequence

ATGAGCAATAAGAGACATAATAAAAGCCAAAAGGAATTAGTTGAGGAACTAATTTAAAGAGGTACCATTAAAACATAAGAAGTAGAATTAGCTATGCTTTCAGTCGATAGATCTGATTTTATAAATAAAGATCCATATTTAGACATTCCTCAATAAATTGGATATAATGTCACTATCTCTGCTCCTCATATGCACGCTTTTAGTTTGTCATATTTATAAAGACATCTGATTTCTGGTAAACCTGTTAGAGTCTTGGATATTGGCTGTGGAACAGGATATCTTTGTCCTGCATTTCTTAAGATGATACCTGTTTAATTTTAATAATAGAGTACTATTGTAGGGATAGACCATGTTAAAGACTTGGTCCAGCTTTCAGATCGTAATATTAGAAAGTCCTTTAGCTAAGAATTAGATAAAAAATAAATTATTTTAGTAACTGGAGATGGTAGGGAAGGTTATTAGCAGCTTGCTCCATATGATGCTATCCATGTTGGAGCTGCAGCAGAAAAAATACCAGAGGCTTTGCTTCAGTAATTAAATTTCGGAGGAAGAATGCTGATACCAGTAGGTAAACATGGTGGTGAATAAGAGTTTTTAGCTATTGATAAAGATTTATAAGGTAAAATAACATAGACTAGATTATTTGGAGTATCGTACGTACCATTAACGAGCATATAAAAGTAGCTTGGAACGTAGAAATGA