TTHERM_00284180

Length: 1452 bp

cDNA Sequence

ATGATTAAAAAATTCGTCTTAGCATTCTTAGCATTTACATAGGCTATCTTAGCTGCTTAAGATCCTTAAGGCAAGCTTCTCTAGGTAGTAGAAACTTTTAGACACGGAGCCAGATACCGTATTTATAATTCTTCTTATCCTAATAACAATTAAATTAATTATGGAGAATTAACTGCTGAAGGATAAAGAATGCACTATGTATTAGGTGTAACCCTTCAATAAAATTATGCTCAAAGTCTTAACTTCCCTGATAAATATGATCACACCTTTATTTATGCCAAGTCTACTAACGTAAATAGAACAATAATGTCTGCTTACAGCTAACTTGCTGGTATGTTCCCCTTAAATAAAGGCATTGATGTTGAAAATATCAACACCTAATTCATGGTTCCTCCTTTTACTAAAATTGCTGATATTGGCTAGTAAAAGTATGCTTTAGCTGGTGGATAACAACCCATCCCAATTCATGTTAAAGAACAAAAAGATGAGAAACAGTTACTTGGTTACGGCGATGCTTGTAATAATTCTCCTAAATGGAGCCAAAAAAATAAAGACGATTCAGACTGGAATAGAATAAAGGGTGAATTCTAACCTTTGATTGACAAATTGGCTAACAACAAATTCTTCCAATTACCTGCTAATCCTGATTTGGATACCATAGCTCAACTTGTTGATACTCTTATTGCAATTAAATGGGCTGGAGATGATGCATAAAATACATTAATTGCCGCATAAATAGAAGGTTTCTTATTACCTCTTGATGAAATGATGAATCCCAATAATTTTAATGTTATGTGGGTCTAAATGAACTTACTCTACTCTATCTAACTTCACTTAGCCCTTTTCAAGACTGAGCAATAAAAGAAAACTTCAGTTACTCCTTTCTTCAATGAATTGTTAGCTTATTTCAATAATTATTTGAGTGCTAAGGATACTTAAAATCCTTTTTTCAAGTGGATCATGCTTTCTGCTCACGATACTACTATAGCCATGGTTGCTCAAGGACTTAACTTAACTAGCTGGTAATGCATGGAATAAGTTAAAAATCAAACTTTTGCTTCAAATCCTAGCTCTCCTTGCATTTACACATATCCAGGTTTTGCATCTAACATCATTTTTGAACTCTATGAGGATAATAACAAGAAACCATACGTCAAAGCTCTCTACAATGGAACTGCATAACCCTTGTGTGGCACTGCTGACACATTCTGTTATCTTGACTAATTCACATAATCAATTTCTTACTCTATTGTATCTGATTTTGATAAAGAATGTGACAACCCTATTTATGTTTCTAGTCCTGACAGTTCTTCAACTCCTACATGGGCTATCGTAGTTATAGTAATAGTTAGCGTTTTGTTTGTTGGTGCTCTAGGTTATATTTTCTTCCAAAGAAAAAAGATTTTATCTTTACAATCTATCGATAAAAATAGCAATTACTCTTAAATTTGA