TTHERM_00285420

Length: 462 bp

cDNA Sequence

ATGGAAGAAAGCTATAAATTTGCTGAGGGGTAAAAAGAAAGCTGGATGAAGGCTAAAACTACTGATTAATTGTGTGATTTTCTAGAATTTGTTTCTCTTCATATAACAAATAAAAGTGTAATCAATGATGTTGTATAAATATTTTTGTTTTTAGAGTAAGTTAACTAAAAGCTCATATCCGACTAAGAGTTCCTTGCTGGCTAATAAAATAAGAATTATATTTATAGCATAGAGAAAGATACCATTCTTAACCGTAAAATAAGAGAGCTACTAGTGCTTATAGAACAGGATATTTAAAAGTTTCTTTGTGAGGATAGAGAGATGCTCACATACATATAAAAAGAATTAGATTTTATTTAAAATTGCTGTATAAGTTCAATAATACCATTCAAAGAGCAAATAATATATATTGTTAGCATGGTTTATAGCGCACTTACAACTTTTGAGAATACTCTAAATTGA