TTHERM_00293300

Length: 2529 bp

cDNA Sequence

ATGATTAGAAATTTATTAAGAATAGGAAGAAAGGGATTTTGCACTTAAGCCACTGCTGATGCAGCAAGCAAAGTAGCCTTTAGCTAATCTATGAAGCCAAAATGGATGAAATTCTTTGAAGGATAAGAACCTATTAAAATAGATCTAGAACGTTCGATGAAGTCTGACAATATTGATTTAATTTAAAATTACATTAAGAATAACTACCTCTAATTTGAAGATTAGCAACTTGTATAAGTTATTCCCAAAGTAAGCAGAAGTAATATTATAGACCGCGTAAAAAATGAAATTAGAGTGAGAATTATTTAGAATAATTTTAATTTGAATGTGAGCTAAAATTTTACTCTACTTGAGTATATGGAAGATATCAGTTAGGCAGATCGTCTATTAGTTTTATATACATTGACTAAATGCAGTGAGAGCTTCAAAGAATATAATCATTTTTAACATTATAAAATAATATAATTAGCTATTAAATTTAATAGATTGTCTGTTCCTTTAACTCTTTAATTCCTTGATTACTTCAATGAAAATAAAGAATTGTTTGCTTAGCCTGATTAAGTTAAAAACTTGTATTTTGAAAAACTTGATTTTGTTCAATTCACACAATATATGCTTGTCTTGAGCAATCTCAAGCTTTTATTAGTTCCTGAAGAATTCAATTCCAGGATTAGTGATGAAACTATTAGGATAATTTCAGAAATATACATCGAAAAGCTAAACACTTTTGAAAGTAACTGCGAAAACTACTACCTAATTCATTTGGATAAGGTCTTTAACCCAGATGTACTCAAAATATTACCTTAAGATTTAAAAATTAGTTACAAAAAGGCACTTTCACATTAGTAAAAAGCTCTTGCTATCTTAAGATCTATTGTTTAAACAAACGAAAGAGAATTAGTTGGAAAGATTCTCATCTTAATAGGAAACTAAATCATGAGCAGAGAAATTAGTGATTTTAAGTTTGACTTCAGATTATTTTCTTACATGACAAAATATCAATATGCATATAAATATTACATTGACGAATCCTTCATTTCTATGAAGAGTTTGCTTAGATCTCTCATATTTAACACAAAGAAATTCAATGAAGAAAATGAAATTAATGCTTATCACATCTTACTATAAAAGTATAAGTCTTATAATGAACTCAACTATCCTAGCATAATTAAATAATCTGAAGATTTTTATTCAAGAAAAGTTGATTTTAGTGATACTATGGTTAATTAATGGAATTAATTACAAAAAGACATACAATAGTGTCTTAGAGATTATATAAATTAACAAGTTGCTTCAGGATTCTTCACTAAATTACTGCACAAAATACCATCACCTGTTGATAAAGAAGAAGATGAAATCATAGCTTAAGAAGATAGTGAAATGGATCTTTTGGCAATAGAAGAAGCAAATGAAGTAATCGCTGATGCTAAAGAAGATGATGATGAATTAAAAAAGAATGGAGAAAATGTAGATGAAAGTGTAAATTAAGAAAAACTTAAAGATGAAGATTTCAAAAAATAGCAAGGATACAAAATAATAGAATTATAATCTAATCTCTAATAACTCAAGTATGTAAAGACTATCACATATAATTCTCGTATTTAATTTAATTAGACTATCCTCTTAAGAAATTTCATCAACACCATTGAATGTGTTGCTTAGAACTTATACTTAAGTGAACCAGATGAAGAGTACATTCATTCCATCAAGTTATTAGTTAAGCAAGATAAATTAATTGAAGTTTTTGATCATTTTTGTATGATTCCTTCTTTCCTTGAAAGCTTAATTATGATAGAAGCTTATGGAAAGATTAAAAAAGGATAGTCATGGTTGAGTCCAGAACTTAGCAACAAAGTTCTAAAAATGAAATTCTTTATGGAAGATTTCTTTAATAAGGATTAAAATTATAAAGATAAAGCTCCTTCTAAATATATCAAATAAATAGAGTAAGAAGTGCAAAGTCTCCCAACTCAGAACCTTCCATTTGACAACGCATATGATTAGCATAATTTCATTTATGAAATCATTAGCAACTCCTTTTAGGTTTCTAATACACTTTTTGAGATTGAAAAATAAAAGACAAGCGTTATAGCAGAAAATAAAATAAATATGTAAAGAAAAAGAGATTTCTTGACAGAGCAATTCGTCTATAATAAAGAGAATCTATTAAGAAAGATAATCCATTCTTAAATTTATAGTTATTTTATCAATGAATCTCATTTAAAAAAATATACTGGTGAAATCTTATTCTCAATTAGTAATTAAGTATAAAAGAATGTTGTCTTCTATCCATTCTTTGCTGATTATGTGCTTCCTTAAAAGAAGATTGCTATATAGATACTCGAAAAAAATAGAATGATCGATGGTGTTGAAAATACAATCTCTGGATTTAATTAATTAAATGAATTGTACTTAAAGCAAATAGGCTACTCTGTAATTTATATAGACTATAATGATTTTGAAATCGACTATAAAGGCTTCCAAACAAATATCTTAAAAAAATTCAGTAAACTCATCAATAATAACTGA