TTHERM_00294580

Length: 1293 bp

cDNA Sequence

ATGTCAGAAGTGTCTCTCCTTCTTAAAAATATTGCGAAGGAAATAGGAAAAGATGAAAAAATCGTTTAGCCATTTATTAACATATTAGAGGATAATTTTTATGATACCATAGAATCAATTAAAGATCTTAAAACAGAAGACTATGAAAAATGGAAATTCCCTAAGCGTATAAGTGATTTGATAATTTAAAAAATATAAGAAACATTATAGGGTAAACCTCAATAAGGGCAGTAATCTGTCTAATCTAATGTCCAATAACAATAAACTTAGCAAAGTAACTAAGTCGTTACTTAATAATCTGAAATGGTTTCTGAACCATCAAAACAAGAATTAATTGTTCAAAAGCTTCAAGATTTGTAAAAAAGTATATCAACTACACAGCGTTATATTGACTTATTAAATTTTGTTAAGAAAATCATCTCAAATATAGCTGCAAATCCTAAAGAATAAAAATTCAGAAGAATCAAGCAATCCAACCAACACTTTTAAATAAACTTTTTGCCTAATAAAGAGGCATTAGAATTCATGTATTTAAACAATTTTAAGCTTGATGAAGAAGGTATATTCTTAGCAGATTAAGATTTAGATATAGAAACTTTGAATTTATCAATTATCAATATTGATAATGCTTTAATAGAAGCAACTCCTTCGAATTTCAATCCTTATTAAACTTATACTTCTGGCAATGAAGTACTTTGTGCTAGAAATTTAGCATAAAAAGAAGGATTTGTAAATTACTATGAAGAACTTTAGAAGCTAAAGGCTAAAAGATTATAAGTAATGTCATAGCCAGTTTCTGATAGAAAAACTAGAGTGTTTATTCAAAATCAAAATTAATCCAGATAAATGGAAATGTAAAATGAAGAAGTTGAAGAGAATTAATTACTCAGAGAATTTTCTGATTAATTAAAAAAAATGATTTAAAATTTAGACAAGCAGCAATTCTCATCGAAAAGTAAGCAAGAATATGAAAAATTGCTAAAAGATCCTGTTTACACAAAATCATTAATAAGAATTAAATTTCCTTAAAATGTTATTCTAGAAGGAAACTTTAGTCCTATGGAAACTATCAAGCATGTCATTGATTTTGTTGCCTTAAATTTAGAAAATCCAGAAGTACCATTCTACTTATTTTAATCTCCTCCTCGTCAAGTATTTGATAAAAGATTCCATCAAAAGACTCTTGATGAAATGGGATGCTTACCAGGAGCTGTTTTTTACTTTGCAATTGACAATGATCCAGAATTCTAAAAGAAATTCTATTTAAAAACAGAATTCAAATAATATTTATGA