TTHERM_00294800

Length: 1281 bp

cDNA Sequence

ATGGGAATAAAAGGAGTAGTTTTAATAGGAGGACCTTATAAAAGTAATTAGTTAGCACCCTTTACTAGCAGTTAGCCCGCTCCATTATTTCCAATTTTACTCATATAACTCTTATAAATAAGTTGCAGGAGTAGAATTGATATATCACCATATTTTTGCATTGTCTTAACTTAAATCGATCACACATATTTACCTGATTGGACTTTTATCTTAAAATGCAGAGCAGAATACAAAAATATATCATTTGAATATCTTTATGAAGAAGAAGAAAAAGGTACAGCAGGCAGTCTTTATTAATTTAAAAACAATTTATTTTGCAAAGAAACAGAAAGTGTCATTCTAATAAATGGAGATATTGCACATAATATAAACCTTTAAGATTTCGTTGATTTTCATAAATCCCTGAAAAACTCTGCATGCACAATCGGAGCTAAACAAAAAGAAGAGCATGAAGACCTATAAAAATATGGCTGTATTATTAAAAATGAATAAACTAAATAAAAACCAGATAATTATGTCTCTGAGTTTCTTATAAATACTGGAATTTATATACTTTCCCCTCTTTTTAGTTAGATATTAGATTATTCTAAGTAAATTAGAAATAGCTCTCTTTTATAAATGTATCCTGAGCATCTCTTATAAAAGCTACACTCTCCTTTATAAAACAATAAGTGGCTTAGCTTAGAAAGTGATGTAATTTCAACTAATATTACAAGTGGATAAATATATGTCTATGAAATTCCTTAGCAAAAGAACTTCTTTTGGACACAAGTTAAATCTCCTATGTAATTTAATTAGAAATTTAGAATATCTAATATATCAATTATTTCTATTTTTAGAGATGTACTTAGGGCTTAAAAGTTTTTATTAAATACATTGAACGTAAACTGCTAAATTTGGAATAAAAGTTATCATTAAAACTGGGAACATAGATAAGAAAGTGTCTTAATTGATACTTTATCATCAATAGATTAATCTGCTGATATAGGCCCTAATGTAGTTATATGTACAGGAGTTACAATCGGAAAAGGTGTTAGAATAAAAAACTCTATTATTTTAGAGGGTTCAATCATAAAAGATCACAGTTTTATAAGCGACAGTATTATAGGATGGCATAGTGAATTAGGGTATTGGAGCAGAGTAGAAGGCACTCCTGATGAAAAAGTTACTATATTAGGATGTGGTGTTAAGGTAGGTAATGAAGTTTCAATAAGAAACTGTGTTGTTTTAAAATAATAGTATTTATCTAGAAATTATAATGATTAATATATTATTTGCTGA