TTHERM_00295100

Length: 3417 bp

cDNA Sequence

ATGAAGAAAAAAAACTTTTAGCTCCTAGAATAAGTAGATCACTCTTCAATTAAATATGAAGCTTTTACTAAAAATTTTTATTAAGAACATCCTGATATTACAAAGCTTACAGAATAGTAAGTTGAAAAAATAAGAAAAGAATTTGAAATAAAGGTTAGTGGAGTCAGACCACCAAAGCCTATTGTAAGTTTTGGTCATTTAGGATTTGACGAAGAGTTAATGAGATAAATCACAAAATTAGGATTTGAAAAACCTACTTAAATTCAATGTCAAGCTCTACCTTGCGGATTAAGTGGTAGAGACATAGTTGGTGTTGCTAAAACAGGTTCAGGAAAAACTGTTTCTTATCTTTGGCCTCTTTTAATTCATATCCTTGATTAAAGAGAATTAGAAAAAAATGAAGGCCCTATTGGGTTAATATTAGCACCAACAAGAGAACTTTGCCAATAAGTCTATACTGAGTCGAAAAGATATGCAAAAATTTATAACATATCAGTTGGAGCTCTTTTAGGTGGAGAGAATAAACATGAATAATGGAAGATGCTTAAAGCTGGTGTCGAAATTCTAATAGCAACACCTGGTAGACTTATGGAGATGATTCAAAAGAAAGCAACAAATCTAAGAAGGTGCACTTACGTAGTTATTGATGAAGCTGATAAAATGTTTAGTATGGGTTTTGAAAAGTAGATTCGTTCAATAATGCAATAGATAAGACCAGACCGTTAAACTTTACTGTTTACTGCTACTCTGAAAAAAAAAATATAAAATTTAGTTATGGATGTGTTAAGAAATCCTGTTACTATTAAGATAGGTGGAGAAAATTAAGCAAATGAAGATATAAGATAGGAGCCAATCATATTTAAGGATTCAAATTTTAAAGATTAATGGATTTTAAATAATTTAAACTTGTGTTTGTAAAAAGGAAAAGTTTTAATTTTTGTTAATCACATTACTAATTGTAATAAATTATCAGAACTGATTAAATAGAGGTTGTACTTAGAAGCACTTGTATTACACGGTGATAAAATACAAAGTGAAAGAACTGATATAATTAATAAATTTAAAGCAGCTAAAAACCTATTAATAGCAACTGATGTTGCTTCTCGTGGTTTGGATATACCTGAAATAAAAACAGTAATTAATTATGATTTACCTCAAGATACTGATACTTATATCCACCGTATTGGTAGAACAGGAAGAGCAGGAGCAACAGATGGCACTGCATATAGTCTGATATTAATGAGTGAAAGTAAATTCGCATCAGATATGCTAAAAGTTATGGAAATAAGCGGTTAGCCTGTCCCACCTAATTTAGAAGAAGTAGCCATGAATGATGATTAATTTAAAGCATAGCGCTTGGCTACAAAGCTAGGTGTTGACTTTGCCAAGGGAAAAGATTCTTCTAAGCTATTAAAATAAGCTCTTTCTAGATAAAGAAACACAAAACATGGACTTGGCTACAAGCAAGAAGATGAACTAAGTATAAAAGACTAAATTAAGGCTGATGTTGATTAGGATATTAAAAAACAAAAAATATCACAAACTCAAGCACCACCTCCTCCATTATTTGATTTAGAATAGTTGATTAGCTAAAAAGATCTACTTGAATAAGAAGAGCAAAAATTATTAAAAGAAAAAGAAAAGGCAATATAGACTTAAAAAATAGTTAGAGAGTATTAAGAGTAGCTGCTACAAACAGGAAAAATAACTTAAGAATAGTTTAACATACAAGCACAATTGTAATAATTATAAATTAATGAGAAAGAAATAATATTTTAGCAAATATAAGACTAATTACAGTTTGTTCGTATTTAAATATAGCAGGCTTAAAATTAAAAATCTTCAATTACTTCAAACAGTTCTAGTAGTTAACAATAGTAATAGCAGTAAAATTAGCCAGTATAAAATTAAGTGCCTTAGAGATAGTCTAGAGAGAGTATAATGGAAAATTTTAGAGATCAGATGAAAAAAGGCATGTAATAATAATTCAGAAGTGGATTTGTGAGTGGAGGAATGCTTCAGAAAAAAAGAGATATTTATGACAAAAATAATTTGGAAATCTAAAATATTTGTTTATAAGTAAATCAAAGAAAAAATTCTGATAAAGAATTCTAAAAAGTAGATATTGTTGTCAGCAGCTAAGTTGAAACAAAAGATGACTTAGAATTAAATGTTGAATAAAATGAAAAAATGTATCTTTTCATGCTCTTCTTGATTGGTATAATTAATAATACAGGGTATGTTTTAGTTGGTACAGCTGCTTAAGATATAGCAAATAAGTTTGATATGAAAAACTTTATGACACTCTTTTAATTATCATTGATTGTTTTATCTGGTGTTATGCGTTCAATCAATTCAAAATTCTTCATTAAAATCTCTCATAAGAAGAGAATATTTGTTTGCATTGTATTATCTATTGGCGCCTATATAATTATTGCTTTTTCTTCAAAAGCTAATGGCAAATGGGGTTTCTATACATGCTTAGTTGGATCGGTAATGTGCGGTACCATGTAGGCATTTGGTGAATCTGTAATGTTAGGTTACTTAAAAGTGTTTCCTTCAAGACTTGTAGCTGGATGGAGTAGTGGTACAGGTTTTGCTGGTCCTTTCGGTTCAGGATTACTTCTTATTTTGAAGGCTGTTAATTTAGATCTTTACATCATATTTTTAATCATGATTCCTATTGAGGCAAGCTATTGGTTATGTTTCTTATGGTATGACAATAGAAAGAGAAAATTCTATAAGTCTAATCAAGTAGGTTCAGAAAGCAATTGCAGTGAAAGCCAATAAGAAGAAGAACTTTCTGAACAACAAAATGAAAATAAATCAATCACTATTAAAGAATCAGAAGATGATGATGCTAAAAACAATAAGAAGTTGTCTATTCAAAATATCAAATCAGTGATGCCAAAAATGTGGACTCTAGCAGTAAATCTTGGATTAGTTTATTATCTCGAATACGTCATTGAAACAGTATGGGCAGAAAGAGCACATCCATAATTAGATAGTGATTAATACTCTGATGACTTTAATGGATTCTTAGAAAAAAATGGTTTTGTTATCCTTTGTTTTTGCTACTAAATTGGTGTATTCATTAGTAGATCATCTTTATATCTCATAAAAATCAGAAAAGTATTTATCTTTACTGCAGCTTAACTTGGTAACTTTGGACTTTGGATTTTCTTTGCAGTAAACAAATCAGTACCTATGGGAGTATAAATTCCATGCATGATTTTTGTAGGATTAATGGGAGGAGCTTCATATGTAAATGTCAATTATTTGTTATTAAATCATTAAGAAATAGACAGAAACGAAAAAGAACTTGCTATGAATATTTGTTCTATTTTTAATGATACAGGTGTACTATTATCGTCTTTAAGTGGTCTAGTTATTGATAATTTTATCATGAAAGACTGA