TTHERM_00297170

Length: 600 bp

cDNA Sequence

ATGTAGCTACCTAAAAAAGATTTATTCTTCTATACTGATAGAGAGAGCCTCACCACATATGTCTATTATAAAAATAAACTTGATTAAAATTATAAAAAAGCAATATACTATCCTGATCAATATGAAACAATGACTAATTCTTAAATTGAAGCATATAGAAGATAAGTTAATTTAAAATTCTTAAAATGGTCATTTTTCAACAAAGATAAAATTCATGAGTCTGCAGACCGTAGAATCATCACTAGCTAGCTTGTTGATTTAAATTTTGGTCTCTTAGGATGTGCTTGTGTTGGTCTCATATTCTTTAAATTTCTTAAAAGAATCGAAGCCCCTTTCTTAGAAATGTATCTAGAAGATAAAGTACTTGGCTTGAATAGTTTAAGATTAATAGCTAGTTCTGGTATTAGCATATATGGATTAAACTATATATATAAACACATTTTTGGATAAAAATATTTATAAGATTTATCATTAGAGTATAAAGAACAATTTTTACCAAATTAAATTGTTGATAGTAAAGTAGAAGGTATTATATAGAAATACTTCCCTTTATAAAAAGATCAATAAACTACCTAAACTGTGGAACCACAACAAAAATGA