TTHERM_00298510

Length: 516 bp

cDNA Sequence

ATGAAGAAAATAAAAGCAAAAGTTTTAGTTGTAGGTGATGCTGCTTGTGGCAAAACAACTTTAATATAAATGTATACAACTAATGGTTAAACCTTCTTGAAAGATTATAATATGACTTAAGCTGCAGAAGTTTCTTCCAAAATCATTCCTTTTCCTGAAAAAGATAAAGATGTAGAGCTTTTCTTTTTTGATATTAGTGGATAAGACTGCTACTAATCGATCACATCTGAGTTACTAGGACAAGCAGATCTTTTAGTTTTAGTTTATGATTGCACAAGCTAAGAAAGCTACAATAAACTTTAGACATGGTATGATAAAGTCAAACAAAAGAATTCTAAATCTCTTTAAGGTGTTTTAATTTCAACTAAAAACGATTTAAGTGGTGCTAGATAAGTAGATCCTCAACAAGCAAGAGACTTAGCAAAGAAACTTAATTTATAATTTTTTGAAGTTTCTTCAGCACGTAATACCAACATAGATCTACCTTTCTAAAACTTAGCAGAAAGACTTGTATGA