TTHERM_00300080

Length: 336 bp

cDNA Sequence

ATGTAGTCAAACTAGGAAAATTAAGATTTAGAAAACTCAACTATTAATAGAGTACCAATAGGAGGAATTACAGATATTGAAGGAGCTAGATTAGTAGCAAGAAGATTATTTGAATAGTATGACAAAAATGGAAGTGGTGAAATTACCTCTTCAGAAATAACAGGTATGATGTAAGATGCTTATAAAGATATGGGAAAAGGATTTAATCCAACAAAAGCAGACACTGATACATTTTTTAATGTTATGGATTTTAATAATGATGGAAGAGTTACATTATAAGATTTAGAAGCTTTAGCTATAAAATTCTTAGCTGGTGCTAACCCAAATAATTTTTGA