TTHERM_00301840

Length: 2331 bp

cDNA Sequence

ATGGACAGATAAATTTAAGATTTTAAAGAGACGATTTGTGAATTCTTTCAAATGGATTTACCAAACATCAATGCAAACAGTGTTTAAGATATTGGATCTCCTTCAAAAAAGAGAGAAATATCTATAGATGAAACCGGATAGATTGGTTTAAAGAATAAATAAATAGTTTACAATTCGAGTAACAATAGCATGAATAAGCGTAAAAGTCCTGATTAAGTTAAAACACCTCCTCCCCATTAAAATCATAGATCAATTAGCCTGCAACCTAATAATTAATCTGTTTTATAATCCTCTCCATAGTAGTAATAACAAAATTAAATGGAAAAGAAAAGTAATCCTCTAAGGAGCTCTTCGATTTTAGATGATTAATTTTTATAGCATGCATCAAATGCCTCAGCTGAAGCTGTTTAATAAGTGGTATCAAATTACAGAAATAATCTTATAAATTAATAATCGCAATCTCTGTAGCAGCCACTTGTAAAGTAACATCCAAAAAATAATTCTAATAACACAAGTAGTTTACAGTAAAGTCCTTAGCATCACTAAGGTAATACTTATTTCCATGACGAAGAACTCTAAGATTTTGAAATTCTAAGCAAATTAGGCGAAGGTTCTTTTAGTACTGTGTATAGAGTTAGACGTGGAAAGGATGGAAAAGAATATGCTTTGAAAAGAATAAAGATGATGAAATTAAATGAAAAAGAAAGGGAAAACGCAGTAAATGAAGTGAGATTTTTGGCTTCAATTAACTGCAGGAATATAATCAGCTACAAATAAGCTATTTATGATGAAGGAGTCAATCAATTATGTGTTATAATGGAATATGCGGAGGGAGGCGATTTAGCTAGAATTATTCGTCATGCTTCAAAAGCAGGTAAATATATTGAGGAAGATATGATTTGGTCATATGCTATTTAAATGACCATAGGCATTAAAGCGTTACATGATTTAAATATATTGCATAGAGATTTAAAGGCAGCTAATGTTTTCTTAGATAAGTATTAAACAAGGGCTATGTTGGGAGACTTGAATGTATCAAAAAAACTACAAGTGAACGGTTTACTTTATACTCAAACTGGTACTCCTTACTATGCCTCTCCAGAAGTTTGGAAAGATAAACCTTACAATAATAAAAGTGATATTTGGAGTTTGGGCTGTGTTATATATGAAATGTGTGCTCTGAAACCACCATTTAAGGGAAAAGATATGGAAGACTTATTTAAAAAGGTATAAAGAGGTGTCTACGATCCTATTCCTTCTCACTTTAGCAAAGAGCTAAACCTCTTCATTGCTTAATTATTAAGGGTAAACCCTGAATAGCGTCCTAATTGTGATGAAATTCTCAAATTTTCTGTGATTAAAAAAAGAATGGCTGATATGCAGCATTTCTTTTCAGATTCTCTTACTCCTTTCTAACAAAAAATGTAATCTGAATTAATAAGCACAATTCGTATTGGGAAGTCTTTACGTGGGTTAAAAGATAAATTGCCTCAGGCAAGATACGAAACAACGGAATCTACTTAAGCTACAACAAATTAAATAACTTCTTAGTCAGAAATTTTACAACCTAATTAATACCACCGTCAAAGAAAAAATAAATACATTTCTCATATATCGTCAAGTAATATAAGTGATATGATGAATTAACAAATAAGCATACCATCTTAACTATTAAATCCGTCTGTAGAAATATAAAGTAAAGGCTTGAATGATAATCACAAAGGAAGTTCAAGTTTGAACTAGAATTCCATTTCTTTAAGATAATCTTAATAACAATAAGTTATCCCTTCTATATAATCATCACCTCCATCATAAAAATCTGAACATATTAAATAAATTATTGCATAAAAATAATAAAATAAATCTTCATTATATTAAAAATAATATTAATACCCACGGTTGCCACTTTAGCATTAATAATTTGATAGTGCCTCTCCAATATAAGCTAAAAGCAGATGTAGTTCTGTAGAAAGTAAGCAATCAATACATAAAAATTAGCTAAGTCTTCATAAGTAATACTACCAAAATAATGATATAAATAAATCTATTAATTTGAATAATTCATAAAACTCTATTGTCACAAATAAAAAACCGATACGAAACAAAGAAAGTAATACACCATAAATGTACTAATTATAAAAAGCAGAAGAACCAATATCAGTCAATTAAAGTGTCCAGTAGCTTTCAAAAGAAATAAAATAATTAAATTCTAATTTATATAATGATGAGATGAATAGTCGCTAGAAAAAAATGTATCAACTTTAAGCTTTATAAAAAATCTTAGATTAAAAATGTTAACTACCTCAAATACTGAAGACATCCATATACTGA