TTHERM_00304350

Length: 558 bp

cDNA Sequence

ATGGATTAAAACAATCAAACTAAAGAATAAAGTCAATAAAAAGAAGAAGTTATGACAAATATTGAACAAGGCGACGAAAATATTAAAGAAGACAACTATTCTTGCGATTTAGTTTTTAAGCTTTTAAATGGGATAAAATTTACAACTTTAGATCATAAACCATGCAAAACAAGTGAAGAATCAGCTTAAGTTAGAGGAGTTTCCTTGGATTCTGGGGCAAAAGCAATGTTACTTAAGGATAAATAAAATATTACATTTATATTAGCTGTTATGTCAGCTAGTAAAAAGCTTTCTTGGAAGCTAATTAGAGGTATTGTTGGACATAAAAAGTTAGATTTAGCTAAACCAGAAGAAGTTTATAGCCTCACAAAATGCATCCCAGGTGCAGTACCACCATTTGGATCCATTTGGGGTATAAAAACTCTTACTGATTAAAGCCTGCTAGATTAAGGAGATGTAATAAACTTTAATTGTGGATTAAGGACTAAGTCGATTTCTATGAAAACTGAAGATTATCTAAATGTTGAAAAACCATAAGTGTGCCAATTTACAGAATGA