TTHERM_00310820

Length: 1236 bp

cDNA Sequence

ATGGATAAGAAAAAACCATTAGTTCTTAAGTATGAAGAAATACAAAATTATTCTCAAGTGCTAGAAACACACAAGTTTTTATAAGATTTAGGAAATGTTATTATAGATAATACAATTAATTCAGCTAAAAATGTAAGCATTGCAGCAGATAACCTATCAAGAACTTAAATTCCTTTACTAGTACTCCAACTCATTCTAAAGAGATATGGTAGTGAAAAGGAATAAAGAGTTAATCTAGACCACTTTGACTTATCTGAAAAAGGAATTATTAGAAGGGTAGGTATAATTGCATTTGCTTCAGCTGTAGGAGAAGCTTTAGCCTATCCTTTCGATAGATTGAAGGTTAGAGAAATAGCTCGCTAAACATTTACAACTAAATCTATTTTCAAAGAAACTAAAGTTATTTATGAAGATATCTTGAAAGCAGAAAAATCATTTGGTGTATTTTACGGATTAAGAGCTGGTATTGATAGGATTCTTTCTTAAAATTTAGTTAGATTTTTTGTGTTTGATTTTTTAGTCGGTCGTCCTCTTTAACCTTACTCGCAAATAAGTGATTTCTAGCTCTACGTGTCTGCTATAGCAGCTTAATCTATGAGTTTTTTAATATAGCAACCTTCTAATATTCTAAAAATTAAAATTTAATGTGAACCTTTAGGTGTAGATTATACTAAATATGAAAGTTATTAAGAAAAATATCGCAAAATAAGTTAGTATCACAAGGGAAAATCTACCATTTTTATGGGAACTGGAATCAGAAGTGGATTGATTCTCTAAAATAGCATAGCAGTATCAGAAATATTTATATTTTTTAAATTTTTAAGATACTTCTACGAAGAAACTGAAATTAAAAGCGATGGGTTTAAGGTATGCACAAGTGCATTATTAACAAGTTTAATTACAACTTCTGTCACTCATCCTCTTGATTTTATTTATCACAGATACTGTATAAGAGCTCTATAAGCTTCAGAAATACCTTCTATAAATAAATACATACAATAACTTATAAAAGAAGATATGGGTATATTTACTCTCTACAAAGGTATTGTACCTTCTCTAATAAGAAACTCTATTTTTACTCTAACTACCTTTTCTCTTTGGAATTACTTCACAACTGTAAGAAGACATGAAGCTTTATATAATTATTATAGTCGTAAATATGAAGAAAAGTTAATGAAATCTGATTCTCATCATAATTATGAAATGACAGGTGGAAGAAAAAATGTTAGGGATTGA