TTHERM_00313450

Length: 1305 bp

cDNA Sequence

ATGGTTAATGCTAGCACTGAATAGCAAAAAGCTATTGAGAAGATTATCAAGGAAAAAAATCCTTATGCAGATAAAGATCATATTTTATTGAGAAAAGATATCCCGTCATACTATTTTCATCCTCACAAGATTTTTGGATTATTTTTGATTATAATAGCTGCTTATTCTCTTATAACTGGAATTTATTTGGCAAATAATTCTTGTGGCTATCAATACTTAGTACTTTCTATACTTGGAGTAACCCCACTAACATTTTTATTTAACATTCAAATTGGAGAAAAGTTTAGTCTATCTAATTTTTATAAAATCTATCTAACACAAGCGATATGGCTTCTTATAATATCGATAGTATCTTTCGGATTCATCGAAAATGTAGTTGAGCAGTCCTACTGCTCTAACATGTGGTGTCATCCTTAAATAAATACAGCAAAGATTAACTGTAAGTGTTTAATCTGCATTGAAAATGTTTTGCTACAAAGATGGAAATTGTTAACTCACAGAGAGCTTTAACGCATAATGTAGATTTTATTAGCTTTTTATTGGTTTTACTTCTCATACAAGCTTAAATATAATAAGATTACCTTCACACTTTATGAGTTAGAAATGATAATGACTAAAAAAGTAAAAGGCCCTGGATAAAGCCATAAGCAAAAATAACTTAAAAAGGGAGTTAGATAAGACGGCGTTGTTGAAGATTAAGCCTCAAATGCTGGTAATGATGCTTAAAATATGTAATAGAAGATTATTAAAAATGTAGTAAATGATGTAGATTAGCTTTTTAGTATTAACTCAGAAAGTACTGAAAAATAAGAGCAAAAAGATGATAAAATTTAAAAGATGAGAGAAGAAAAAATAAAAGAATTAATGCAACAATAAAAAAATTTAGGAGAAAGTTTAGACTTTGTCATAAATCTTCGTAGAAAATCTCAATAAGATATAGAAAACTAAATCCATAATATAAGTTTTTCACAAAAAGATGAAGATTTTGTAAATAAAGTAGATAGTAAAATTGACGATAACAACAATACCAATTACATGTTTACAGATAATTTAAGCTATTTAAATCAAAACAACATGAGTTTTAATCTAGATACATAGAATGTAATAAGGTAAGATGATGACTATGATAATACTATTTTGCCATTCTAGCCAACTCAAACAAGATTTTATGAAAATCCTGAAATGAATAATACTGTGCATAACTTTTCCTATACTAATGAAGTCAATGACCATGAAATTTCAATGCACGAAATATCTCCTACTTAAAATAATGAATAATAAAAATAATAAACAGATAATAATTGA